tesi dottorato Loizzo Annalivia2

May 9, 2018 | Author: Anonymous | Category: Scienza, Biologia, Biochimica, Genetica
Share Embed


Short Description

Download tesi dottorato Loizzo Annalivia2...

Description

UNIVERSITÀ DEGLI STUDI DI ROMA "TOR VERGATA" FACOLTA' DI MEDICINA E CHIRURGIA

DOTTORATO DI RICERCA IN NEUROPSICOMOTRICITA' DELL' ETA' EVOLUTIVA

XX CICLO DEL CORSO DI DOTTORATO

Identificazione del gene di una nuova leucodistrofia con atassia, sordità e cardiomiopatia

Dott.ssa Annalivia Loizzo

Docente Guida/Tutor: Prof. Augusto Pasini Coordinatore: Prof. Paolo Curatolo

INDICE ABSTRACT

Pag.

3

1. INTRODUZIONE

Pag.

5

1.0

La mielina

Pag.

5

1.01

La mielina, dalla struttura alla funzione

Pag.

6

1.02

Il processo di mielinizzazione

Pag. 18

1.1

Metodiche di brain imaging

Pag. 21

1.2

I disordini della sostanza bianca

Pag. 33

1.2.0

Le Leucoencefalopatie

Pag. 33

1.2.1

Leucoencefalopatie acquisite

Pag. 35

1.2.2

Leucoencefalopatie connatali

Pag. 39

1.2.2,1

Leucodistrofie primarie con disturbo metabolico noto

1.2.2,2

Leucodistrofie primarie con diturbo metabolico non conosciuto

1.2.2,3

Pag. 88

Leucodistrofie secondarie ad alterazioni metaboliche/ degenerative

1.3

Pag. 42

Leucodistrofia con atassia-sordità-cardiomiopatia (ADCL)

Pag. 139 Pag. 169

2. EXCURSUS METODOLOGICO-CLINICO DEL LAVORO SVOLTO ED OBIETTIVI DELLA RICERCA 2.0

Obiettivi

Pag. 170

2.1

Excursus metodologico-clinico

Pag. 170

3. MATERIALI E METODI 3.0

Campione esaminato

Pag. 172

3.1

Estrazione “rapida” del DNA genomico da sangue periferico

Pag. 172

3.2

Amplificazione di sequenze specifiche mediante PCR

Pag. 173

3.3

Elettroforesi su gel

Pag. 175

3.4

Sequenziamento automatico

Pag. 176

3.5

Studio di linkage genetico

Pag. 176

3.6

DNA-pooling

Pag. 177

1

3.7

Enzimi di restrizione: RFLP (restriction fragment length polymorphism)

Pag. 179

4. RISULTATI 4.0

4.1

Descrizione casi clinici

Pag 180

4.0.1 Famiglia n.1

Pag. 180

4.0.2 Famiglia n.2

Pag. 186

4.0.3 Esami di esclusione

Pag. 189

Identificazione del gene

Pag. 190

5. DISCUSSIONE 5.0

5.1

Definizione clinica della leucodistrofia individuata e diagnosi differenziale

Pag. 195

Caratteristiche del gene

Pag. 197

6. CONCLUSIONI 6.0

Posizione della leucodistrofia individuata all’interno della classificazione generale di tali patologie e sviluppi clinici futuri

6.1

Pag. 200

Direzioni della ricerca verso la definizione dell’espressione del gene nei vari tessuti e la sua caratterizzazione funzionale

7. BIBLIOGRAFIA

Pag. 202

Pag. 206

2

ABSTRACT Oggetto: Il presente lavoro descrive una nuova entità clinica di leucodistrofia e lo studio genetico effettuato per il riconoscimento del gene responsabile. Descrizione del fenotipo clinico: Si tratta di una nuova malattia neurodegenerativa riscontrata

inizialmente

in

3

individui

appartenenti

ad

una

famiglia

multiconsanguinea. L’esordio è precoce e caratterizzato da una sindrome atassica lentamente progressiva e spasticità. Successivamente i pazienti presentano una ipoacusia neurosensoriale, che evolve in una sordità completa. Infine sviluppano una cardiomiopatia rapidamente ingravescente, causa del decesso entro la seconda decade di vita. La risonanza magnetica evidenzia alterazioni diffuse della sostanza bianca nelle sequenze T2 pesate. Un estensivo screening neurometabolico ha evidenziato unicamente un lieve incremento dei valori degli enzimi epatici. Caratterizzazione genetica: Per ricercare il gene responsabile di questa nuova condizione clinica, è stato effettuato uno studio di linkage. Mediante l’utilizzo di 384 primers, è stato analizzato l’intero genoma dei 3 probandi, attraverso la tecnica del DNA pooling, che ha consentito di selezionare 21 regioni candidate. Inserendo tutti i primers informativi, analizzando l’intera famiglia, e attraverso lo studio di analisi dell’aplotipo, è stato identificato il locus sul braccio corto del cromosoma 1 (1p34). Tramite sequenza diretta, sono state analizzate le porzioni codificanti di tutti i geni presenti all’interno della regione e le loro sequenze introniche fiancheggianti. E’ stata così trovata una mutazione puntiforme missenso, non rilevata nella popolazione generale, responsabile della sindrome. Sono stati individuati, successivamente, altri 4 pazienti, con caratteristiche cliniche sovrapponibili, non legati alla nostra famiglia, con una variante della stessa mutazione. Parole Chiave: Leucodistrofia, Atassia, Sordità, Cardiomiopatia, gene ADCL.

3

ABSTRACT Object: This paper described a new clinical entity of leukodistrophy and the genetic study for gene’s identification. Clinical phenotype: We reported initially three patients, from a large consanguineous family, showing a distinctive white matter disease, at early onset, with a clinical phenotype characterized by slowly progressive cerebellar ataxia and spasticity. Liver enzymes were elevated in the patients, but extensive neurometabolic studies failed to detect any specific biochemical abnormalities. As this disease progressed, all patients experienced sensory-neural deafness, resulting in complete hearing loss, and developed a restrictive cardiomyopathy after the age of 13 years and leading to death in two cases. In the three propositi, brain MRI showed a diffuse abnormal white matter signal on T2-weighted images . Genetical descriptions: Aiming at the identification of the specific gene, we performed a genomewide linkage analysis in affected and not-affected members of this first family. Due to the high consanguinity, we initially used the DNA pooling method to look for the region of homozygosity. Using a set of microsatellite markers distributed along the 22 autosomes, we detected initially 21 candidate regions. Extending the analysis to individual DNA from the non affected siblings, and using additional markers, we found a likely region of homozygosity on chromosome 1p34.3-p33. We analyzed the coding sequence and flanking intronic regions of these genes, and we found a missence mutation liable to this leuckodistrophy. In the same time, we analysed a second consanguineous family in which the same clinical phenotype was present. The sequencing of the genes allowed finding 2 homozygote variations in gene ADCL for the 2 families. Key-words: Leukodistrophy, Ataxia, Deafness, Cardiomyopathy, ADCL gene.

4

INTRODUZIONE

L’esposizione del lavoro svolto è stata organizzata secondo il seguente schema: i. introduzione alle caratteristiche della sostanza bianca (struttura, funzione, mielinizzazione) ed alle metodiche di studio tramite strumenti diagnostici per immagini; ii. breve descrizione e tassonomia delle leucodistrofie segnalate in letteratura. Tale classificazione costituisce un lavoro originale, in quanto, in letteratura, non è presente una catalogazione condivisa delle patologie della sostanza bianca. La classificazione proposta rappresenta, quindi, una scelta individuale, operata nel contesto di questo scritto e motivata dalla scelta di definire forme primitive, in cui le manifestazioni cliniche dominanti sono legate alle alterazioni della sostanza bianca, e forme secondarie, in cui la sintomatologia è riconducibile ad un interessamento sistemico; iii. definizione degli obiettivi della ricerca; iiii. descrizione del metodo; iiiii. esposizione analitica dei risultati; iiiiii. discussione dei risultati esposti; iiiiiii. conclusioni con schema delle possibili direzioni future della ricerca sull’argomento trattato.

5

1.0

LA MIELINA

1.0.1 La mielina dalla struttura alla funzione La mielina ([email protected] = midollo), il cui nome fu introdotto da Virchow nel 1854, è una struttura spiraliforme formata dalle estensioni della membrana plasmatica delle cellule gliali intorno alla superficie assonale. Costituisce

una

delle

“invenzioni”

filogenetiche

più

recenti

nella

storia

dell’evoluzione degli organismi viventi e la sua comparsa può essere fatta risalire all’incirca a 400 milioni di anni fa, come testimoniato dalla sua presenza nei soli vertebrati (eccettuate le forme evolutivamente più remote come l’agnathan cyclostomata o la lampreda). Ampiamente rappresentata sia a livello del Sistema Nervoso Centrale che Periferico, dei quali costituisce oltre il 40-50% in peso secco, la mielina svolge un ruolo di primo piano nel favorire la conduzione degli impulsi nervosi. Alta velocità di conduzione, preservazione delle caratteristiche del messaggio neuronale anche alle lunghe distanze, ed economia spaziale, sono solo alcuni dei vantaggi conferiti dal rivestimento mielinico. Sebbene nel passato si fosse posto l’accento sulla sola funzione “isolante” della mielina, negli ultimi anni è stato possibile evidenziare come questa non si limiti a svolgere una mera azione meccanico-elettrica, ma partecipi attivamente al metabolismo assonale. L’alterato sviluppo del citoscheletro assonale in assenza di mielina, il ricco contenuto enzimatico della mielina stessa, il plausibile ruolo di tamponante ionico in prossimità della superficie dell’assone, nonché la funzione di trasportatore proteico da e verso la membrana, sono alcuni esempi della sua multifunzionalità. La sua organizzazione spazio-strutturale e la sua peculiare composizione (abbondanza

6

di contenuto lipidico e scarsa componente acquosa) giustificano molte delle esclusive caratteristiche funzionali: Organizzazione spazio-strutturale: Le cellule gliali, gli oligodendrociti a livello del SNC (Sistema Nervoso Centrale) e le cellule di Schwann nel SNP (Sistema Nervoso Periferico), partecipano in maniera differente alla costituzione della guaina mielinica; se, infatti, ciascun oligodendrocita si mette in connessione con più di 50 differenti assoni, la cellula di Schwann partecipa alla costituzione della guaina mielinica di un solo assone. La mielina presenta un’organizzazione tipicamente segmentale: gli avvolgimenti a mo’ di spirale, che le cellule gliali (γλ[email protected]α = colla) inviano intorno alla fibra assonale, formano guaine unitarie di 150-200µm di lunghezza e fra una guaina mielinica e la successiva si determina uno spazio, nodo di Ranvier, a livello del quale il rivestimento mielinico è assente (Figura 1).

Figura. 1: Principali caratteristiche di un neurone di vertebrato. Lo schema mette in evidenza le diverse zone del neurone ed è possibile rilevare la peculiare disposizione della guaina mielinica caratterizzata

dall’alternanza

di

segmenti

internodali e nodali (tratto da Kandel et al.).

I nodi di Ranvier, ricchi di canali del sodio, sono così esposti direttamente al milieu extracellulare, mentre gli spazi internodali presentano una bassa capacitanza elettrica

7

proprio a causa del rivestimento mielinico ricco di lipidi che funziona da isolante. L’insieme di questi due elementi motiva la conduzione saltatoria (l’impulso salta da nodo a nodo piuttosto che progredire lungo la fibra) che è la base dell’elevata velocità di conduzione propria delle fibre mielinizzate (Figura 2).

Figura 2: Conduzione saltatoria delle fibre mielinizzate (tratto da Baumann et al. 2001)

Accanto all’organizzazione segmentale del rivestimento mielinico, nel senso della lunghezza è presente una periodicità degli strati del rivestimento, data dall’alternanza di uno strato concentrico elettrondenso seguito da un doppio strato di minore densità elettronica con una successione di 12 nm fra l’uno e l’altro (Figura 3). Questa caratteristica è da mettere in relazione alla alternanza lipidi-proteine-lipidi che sarà precisata nella parte relativa alla sua costituzione macromolecolare.

Figura 3: Organizzazione e periodicità del rivestimento mielinico (tratto da Barkovich A.J. 2005).

Composizione della mielina: La mielina è costituita, in peso secco, da un 70% di

8

lipidi e da un 30% di proteine e si caratterizza per un basso contenuto acquoso pari a circa il 40% (contro lo 80% presente nella sostanza grigia). Proprio il rapporto lipidi/proteine, che è caratteristico della mielina, le fornisce le proprietà isolanti ed insieme giustifica la sua periodicità (Figura 4). Figura 4: Cellule gliali e struttura mielinica a livello del SNC e del SNP. Nella figura in alto a sinistra è presente uno schema dell’organizzazione della mielina nel SNP: si evidenzia come in corrispondenza della porzione più interna ed esterna della guaina mielinica siano presenti zone in cui la mielina risulta meno compatta e le cellule gliali conservano una piccola quantità di citoplasma. Una certa quantità di citoplasma permane anche nella parte terminale delle lamelle mieliniche in vicinanza dei nodi di Ranvier (anse paranodali o paranodal loops). Sono inoltre presenti una serie di incisure (incisure di Schmidt-Lanterman) corrispondenti alle facce citoplasmatiche del rivestimento mielinico che non si sono compattate a formare la linea a maggiore densità elettronica. In alto a destra l’organizzazione della mielina nel SNC: un singolo oligodendrocita partecipa alla mielinizzazione di più fibre assonali. In basso l’organizzazione ultrastrutturale della mielina e uno schema delle proteine che partecipano alla sua costituzione (tratto da Baumann et al. 2001).

a) Contenuto lipidico: I lipidi presenti negli oligodendrociti e nella mielina sono gli stessi presenti in altre membrane cellulari, ma in proporzioni differenti. La mielina contiene, infatti, colesterolo, fosfolipidi e glicolipidi con un rapporto molare di 4:3:2 o 4:4:2. I glicolipidi ed il colesterolo sono per lo più presenti negli strati più esterni della membrana cellulare, esposti all’ambiente extracellulare, mentre i fosfolipidi sono disposti sul versante citoplasmatico della membrana, fra gli uni e gli altri si collocano gli acidi grassi a catena lunga (Figura 5).

9

Figura 5: La mielina è composta da strati multipli che presentano una tipica alternanza lipidiproteine-lipidi. Gli strati lipidici sono rappresentati dalle membrane cellulari, composte da un doppio strato di colesterolo, fosfolipidi e glicolipidi. Una linea elettrondensa (major dense line) contiene la proteina basica della mielina (proteina intracellulare connessa alla faccia interna della membrana). Una linea a minore densità elettronica (intraperiod line) è formata dalla proteina PLP (proteolipid protein) che interagisce con un’altra catena di PLP presente nel giro adiacente della spirale mielinica (tratto da Barkovich A.J. 2005).

Gli esteri del colesterolo sono assenti ed i fosfolipidi, che rappresentano il 40% del contenuto lipidico totale, non presentano caratteristiche peculiari se si eccettua l’alta proporzione di fosfogliceridi dell’etanolamina sotto forma di plasmalogeni che costituiscono un terzo del contenuto lipidico. Una delle maggiori caratteristiche dei lipidi della mielina è però l’alto contenuto di glicosfingolipidi, ed in particolare di galattocerebrosidi, galattosilceramidi (GalC) e dei loro derivati solfato (sulfatidi e sulfogalattosilceramide). Sebbene non esista un lipide esclusivo della mielina, si può ragionevolmente affermare che i GalC sono considerati, se non esclusivi, quantomeno tipici della mielina. Questi glicosfingolipidi formano una famiglia complessa di elementi che differiscono fra loro non solo per quanto concerne la parte ceramidica, ma anche per la componente sfingosinica (18-20 atomi di carbonio) e per gli acidi grassi a catena molto lunga, la cui biosintesi avviene in sede microsomiale. Nella mielina sono presenti infine gangliosidi, derivati sialilati dei galattocerebrosidi, ed in particolare i sottotipi GM4 e GM1. b) Proteine della mielina: Le proteine costituiscono il 30% in peso secco della mielina e sono per la maggior parte proteine sito-specifiche. Le forme maggiormente rappresentate sono la MBP (Myelin basic protein) e la PLP o Proteolipid Protein (compresa l’isoforma DM20),

10

che presentano un basso peso molecolare e da sole costituiscono lo 80% del contenuto proteico totale. Un secondo gruppo di proteine, in ordine di concentrazione percentuale, è indicato col termine generico di proteine di Wolfgram (dal nome dell’autore che per primo ne sospettò l’esistenza) e comprene essenzialmente la CNP (2’,3’-ciclonucleotide 3’fosfodiesterasi) e sue sottoforme. Un terzo gruppo è quello delle glicoproteine, tra le quali vanno annoverate la MAG (Myelin associated glicoprotein) e la MOG (myelin/oligodendrocyte glycoprotein). Da ultime, sono presenti nella mielina proteine dotate di attività enzimatica.

Figura 6: Organizzazione del doppio strato lipidico che, nella mielina, è composto da colesterolo, fosfolipidi e glicolipidi in rapporto molare di circa 4:3:2. La maggior parte dei glicolipidi (galattocerebrosidi e solfatidi) e del colesterolo sono concentrati nello strato esterno della membrana, mentre la maggior parte dei fosfolipidi (i più numerosi dei quali sono i plasmalogeni contenenti etanolamine) si trova nello strato interno (tratto da Barkovich A.J. 2005).



MBP (Myelin Basic Protein): E’ la famiglia di proteine maggiormente

rappresentata a livello del SNC e comprende diverse isoforme che differiscono per peso molecolare e composizione aminoacidica derivando da un processo di splicing alternativo di un comune mRNA precursore. Identificate dapprima nel topo (Eylar et al. 1971) e poi nell’essere umano (Carnegie et al.1971), sono codificate da un gene localizzato sul cromosoma 18q22-qter formato da sette esoni (10 se si contano i tre esoni upstream chiamati Golli [gene expressed in the oligodendrocyte lineage], che caratterizzano la forma proteica espressa al livello del SNC rispetto alle forme presenti nel sistema immunitario o all’interno degli stessi neuroni) per una lunghezza

11

totale di 45kb. Le diverse isoforme derivano da trascritti alternativi e le più rappresentate hanno massa molecolare di 21.5, 18.5, 17 e 14 kDa. Le isoforme di 21.5 e 20.2 kDa, che contengono il trascritto del secondo esone, sono maggiormente espresse nel corso della mielinogenesi e ricompaiono nelle lesioni croniche da Sclerosi Multipla in corso di rimielinizzazione. La subunità aminoterminale subisce modificazioni post-trascrizionali (acetilazione, fosforilazioni e metilazione). Ci sono evidenze indirette di come la sua metilazione possa rivestire un ruolo importante nel conferire una forma compatta alle membrane nel corso della maturazione. La MBP è localizzata sul versante citoplasmatico delle membrane mieliniche (Figura 6) e si pensa che sia responsabile della linea elettrondensa visibile alla microscopia elettronica. La proteina riveste un ruolo importante nella stabilizzazione della struttura spiraliforme della mielina interagendo con le cariche negative dei fosfolipidi di membrana. • Proteolipid proteins (PLP e DM20): Furono scoperte per la prima volta nel 1951 quando Folch e Lees evidenziarono che una certa quantità di proteine della mielina poteva essere estratta dalla sostanza bianca tramite solventi organici; i due autori le denominarono proteolipid protein proprio perché apparivano costituite da un coacervo lipoproteico. Rappresentano fino al 50% del contenuto proteico della mielina; la forma predominante (PLP) ha un peso di 25kda, mentre la DM20 ha un peso di 20 kDa; peso che aumenta in seguito all’acetilazione ed al legame, tramite residui di cisterna, con gli acidi palmitico, oleico e stearico. Sono codificate da un gene localizzato sul cromosoma Xq22 di lunghezza pari a 15kb, organizzato in sette esoni. Sia la PLP che la DM20 provengono dal medesimo gene,

12

ma l’mRNA della PLP comprende tutti e sette gli esoni, mentre la DM20 manca della porzione corrispondente all’estremità 5’ del terzo esone, con una conseguente delezione di 35 aminoacidi nella sequenza della proteina. La proteina presenta quattro α-eliche idrofobiche, due domini extracitoplasmatici e tre domini citoplasmatici (comprendenti le estremità amino e carbossiterminali). PLP e DM20 sembrano rivestire il medesimo ruolo, anche se la DM20 è presente in maggiore quantità nel corso dello sviluppo cerebrale, mentre la PLP diviene quantitativamente predominante nel corso della differenziazione degli oligodendrociti e durante la mielinizzazione. La porzione extracellulare di una proteina PLP si mette in contatto con la regione omofilica della PLP della spirale adiacente e, grazie a residui lipofilici di triptofano, interagisce con i galattocerebrosidi. Questo porta alla stretta apposizione delle membrane delle spirali ed al compattamento della mielina. La microscopia elettronica permette di evidenziare come l’interazione delle membrane determinata dalla PLP corrisponde alla linea intraperiodica descritta. Le mutazioni della PLP, così come quelle dei galattocerebrosidi, determinano una instabilità della mielina che degenerera in corrispondenza della linea intraperiodica. Nel 1993 sono state identificate due nuove proteine (M6a e M6b) che mostrano un’identità di sequenza con la DM20 pari al 56 e al 46%, suggerendo la possibile esistenza di una famiglia di proteine omologhe. • CNP (2’,3’-ciclonucleotide 3’-fosfodiesterasi): E’ una proteina ad alto peso molecolare e rappresenta il 4% delle proteine della mielina, sebbene la sua concentrazione sia variabile secondo lo stadio maturativo. E’ codificata da un gene localizzato sul cromosoma 17q21, formato da quattro esoni per una lunghezza di 7kb, che codifica per due isoforme proteiche, CNP1 e CNP2 (46 e 48 kDa), ottenute per

13

splicing alternativo da due diversi codoni d’inizio della traduzione. Le due proteine vengono quindi acilate e fosforilate e si associano alla membrana citoplasmatica degli oligodendrociti dopo isoprenilazione, in particolare la CNP1. La CNP è presente nella mielina, ma anche nei fotorecettori retinici. Possiede due o tre domini di legame del GTP e la porzione carbossi-terminale è analoga alle proteine GTP-binding della famiglia Ras. La sua attività funzionale è sconosciuta, se si esclude il dominio catalitico che idrolizza i 2’-3’-nucleotidi ciclici a 2’-derivati (nucleotidi assenti nel Sistema nervoso), anche se la sua sovraespressione conduce, nei modelli animali, ad un eccesso di mielina con formazione di vacuoli ed inadeguata fusione delle membrane oligodendrocitarie. E’ stato così supposto che la CNP svolga una funzione di stabilizzazione del citoscheletro mielinico e che funga da regolatore degli eventi che conducono alla mielinizzazione del SNC. • MAG (Myelin associated glicoprotein): Rappresenta solo l’1% delle proteine della mielina nel SNC e lo 0,1% nel SNP. E’ codificata da un gene localizzato sul cromosoma 19, formato da 13 esoni, per una lunghezza totale di 16 kb. Sono state identificate due isoforme, la large MAG (L-MAG) e la small MAG (S-MAG), di 72 e 67 kDa (100 kDa quando glicosilate), che presentano un tratto transmembranario ed una regione extracellulare che contiene cinque segmenti omologhi che fanno parte della superfamiglia delle immunoglobuline. Le due isoforme differiscono nel dominio citoplasmatico e sono il risultato di uno splicing alternativo dell’esone 12 dell’mRNA. Nel SNC la MAG è confinata in sede periassonale, mentre a livello del SNP presenta una distribuzione diffusa. Una differente ripartizione caratterizza anche le due isoforme, il che fa sospettare che le due proteine svolgono compiti differenti. Numerosi sono i modelli animali sviluppati nel tentativo di definire l’attività

14

funzionale delle due isoforme proteiche, nei topi Knock-out è stata evidenziata la presenza di un collare citoplasmatico periassonale con organelli citoplasmatici all’interno delle lamelle, che indicherebbero un blocco della formazione e del compattamento della mielina, associati ad una oligodendropatia retrograda di origine tossica. Gli studi sui topi MAG-null e mutanti LMAG hanno evidenziato che la LMAG è l’isoforma critica per il SNC, mentre la SMAG lo è per il SNP. Per lungo tempo le MAG sono state considerate un potenziale recettore per l’inizio e la progressione della mielinizzazione; in effetti, le MAG sono espresse tipicamente dalle cellule mielinizzanti e la loro iperespressione porta ad una precoce mielinizzazione, mentre una loro assenza causa ipomielinizzazione. L’evidenziazione però di un dominio L2/HNK1 fa pensare che le MAG svolgano anche un ruolo nel processo di riconoscimento intercellulare ed in particolare nell’interazione neuroneoligodendrocita, come dimostrato dagli studi con anticorpi anti-MAG. Da ultimo si è ipotizzato che le MAG fungano da inibitori della formazione delle escrescenze neuritiche e della rigenerazione post-lesionale (una proteasi calcio dipendente taglia la MAG vicino al dominio transmembrana e forma un peptide di 90 kDa solubile responsabile della demielinizzazione in quanto presente in maggiore concentrazione nella sostanza bianca dei pazienti affetti da SM). Uno studio sul ratto ha evidenziato che il dominio L2/HNK1 è responsabile dell’attivazione della Fyn, una protein-tirosin-chinasi della famiglia src. La recente dimostrazione

del

ruolo

delle

tirosin-chinasi

nella

differenziazione

degli

oligodendrociti apre, quindi, nuove prospettive di ricerca. • MOG (myelin/oligodendrocyte glycoprotein): Fu per la prima volta identificata come parte di un antigene (l’M2) che induceva l’encefalomielite autoimmune nel guinea pig. E’ l’unica proteina in grado di scatenare sia un’infiammazione T-mediata,

15

che una malattia demielinizzante autoimmune nei modelli animali. Codificata da un gene localizzato sul cromosoma 6p21.3-22, è una proteina di 26-28 kDa, dotata di domini aminoterminali appartenenti alla superfamiglia delle immunoglobuline. Localizzata sulla superficie esterna della guaina mielinica, si pensa abbia una funzione nella trasduzione dei segnali provenienti dallo spazio extracellulare. Espressa nei soli mammiferi, compare tardivamente rispetto ad altre proteine della mielina, tanto da far pensare ad un ruolo funzionale selettivo per gli oligodendrociti maturi rimanendo probabilmente inattiva nel corso della mielinizzazione. • Altre proteine della mielina: Proteine basiche di piccole dimensioni: MOBP (Myelin-associated/olygodendrocyte basic protein): Codificata da un gene localizzato sul cromosoma 3p22, è presente in tre isoforme, frutto di uno splicing alternativo. Svolge probabilmente un ruolo simile alla MBP nel compattamento della mielina. P2: Proteina di 13,5 kDa è presente anche nel SNC sebbene sia peculiare del SNP. E’ prevalentemente localizzata a livello midollare. Membri della famiglia delle tetraspan-protein: Oltre alla PLP nel SNC, e alla PMP22 e Cx32 nel SNP, altre proteine accomunate dalla presenza di quattro α-eliche transmembrana sono: OSP (Oligodendrocyte-specific protein): Codificata da un gene localizzato sul cromosoma 3q26.2-26.3, è una proteina di 22 kDa simile alla PMP22, ed è la più abbondante proteina della mielina dopo la MBP e la PLP/DMM20 (∼7%). Fa parte delle tight-junction, claudin-11, e funge da mediatore nell’arrangiamento parallelo delle giunzioni stesse. Cx32: Recentemente identificata nel SNC, ha un ruolo importante all’interno delle

16

gap-junction. Altre proteine minori: Omgp (Oligodendrocyte-myelin glicoprotein): Codificata da un gene sul cromosoma 17q11-12, è parte dell’introne del gene la cui mutazione è responsabile della neurofibromatosi tipo I. La proteina presenta una localizzazione principalmente paranodale. Myelin/Oligodendrocyte specific protein: E’ una proteina di 48 kDa localizzata sulla superficie extracellulare degli oligodendrociti. RIP antigen: E’ una proteina tipica degli oligodendrociti e delle guaine mieliniche. Proteine NI-35/250: Sono proteine legate alla membrana che svolgono una funzione inibitoria sull’accrescimento assonale. Enzimi oligodendrocitari: Nella mielina è stata identificata la presenza dell’UDPgalattosio-ceramide galattosiltransferasi. Codificato da un gene sul cromosoma 4q26, costituito da 5 esoni di lunghezza >45kb, è un enzima che cresce in parallelo allo sviluppo neuronale ed alla concentrazione dell’MBP. Nei topi knock-out, all’apparente normalità del rivestimento mielinico, si contrappone una perdita della funzione isolante della mielina con arresto della caratteristica conduzione saltatoria dell’impulso neuronale. Col passare del tempo i topi sviluppano tremore generalizzato ed atassia e presentano la vacuolizzazione della porzione midollare anteriore, dimostrando come i GalC ed i sulfatidi siano fondamentali per lo sviluppo delle regioni nodali e paranodali. Altri enzimi evidenziati in corrispondenza della mielina sono la neuroamminidasi, la colesterol-estere idrolasi, gli enzimi di sintesi e catabolismo dei fosfolipidi, gli enzimi del metabolismo dei fosfoinositidi, proteasi, proteinchinasi e fosfatasi.

17

1.0.2 Il processo di mielinizzazione La mielinizzazione inizia durante il quinto mese di vita fetale a partire dai nervi cranici, e continua progressivamente nel corso dello sviluppo. In linea generale la mielinizzazione procede caudo-rostralmente (il tronco encefalico mielinizza prima del cervelletto e dei gangli della base, e il cervelletto e i gangli della base prima degli emisferi cerebrali) ed inoltre le regioni dorsali, a prescindere dai distretti, mielinizzano prima delle regioni anteriori (il rivestimento mielinico si forma prima nella porzione dorsale del tronco encefalico, contenente il lemnisco mediale ed il fascicolo longitudinale mediale, che nella porzione ventrale, contenente i tratti corticospinali). Mielinizzano prima le strutture che, nel corso della maturazione, comprendono sistemi funzionali utilizzati precocemente, e solo dopo di quelle che sovrintendono a funzioni dell’età più matura. Il fascicolo longitudinale, i lemnischi mediale e laterale, i peduncoli cerebellari superiori ed inferiori, che trasmettono informazioni vestibolari, acustiche, tattili e propriocettive sono mielinizzati alla nascita, mentre i peduncoli cerebellari medi, che trasportano i segnali motori al cervelletto, più tardivamente. Allo stesso modo i corpi genicolati e la corteccia calcarina (porzione ottica), la corteccia postcentrale (somestesica) e precentrale (propiochinestesica) acquisiscono il rivestimento mielinico prima della corteccia parietale posteriore, frontale e temporale anteriore (aree sensitive associative). La mielinizzazione procede rapidamente nei primi due anni di vita e rallenta successivamente, anche se fibre provenienti e dirette alle aree associative continuano a mielinizzare anche nel corso della terza e quarta decade di vita (Figura 7).

18

Figura 7: Mielinizzazione del SNC durante lo sviluppo. Lunghezza e spessore delle linee identificano la progressione del processo di mielinizzazione (da Baumann et al. 2001).

Il segnale responsabile dell’attivazione degli oligodendrociti e che “indica” qual’è l’assone che debba essere mielinizzato, rimane sconosciuto. Gli studi su modelli animali fanno supporre che si tratti di un complesso di segnali differenti che collaborano all’attivazione funzionale delle cellule gliali. Esisterebbe una sorta di diametro critico dell’assone superato il quale sarebbe attivato il processo di mielinizzazione. L’interazione fra la proteina Notch, espressa dagli oligodendrociti, ed il corrispondente ligando Jagged sulla superficie della membrana assonale, avrebbe una funzione critica nell’attivazione degli oligodendrociti, come dimostrato dall’effetto della downregulation del Jagged che porta ad un ritardo di maturazione dei precursori oligodendrocitari. La stessa attività elettrica neuronale fungerebbe da segnale d’attivazione del processo di mielinizzazione, come dimostrato dal fatto che la tetrodotossina e l’α-tossina dello scorpione, che agiscono bloccando l’attività elettrica neuronale, ritardano la mielinizzazione. Anche il sistema microtubulare oligodendrocitario avrebbe funzione di controllo della formazione della mielina, così come dimostrato per le proteine MAP o microtubuleassociated protein ed in particolare dal ruolo delle proteine MAP2c e fibronectina tipo

19

III. Il medesimo assone si comporterebbe come parte attiva nella regolamentazione dello spessore dello strato mielinico. Gli astrociti infine, oltre a rilasciare fattori di crescita e differenziazione oligodendrocitaria, rivestirebbero un importante ruolo nella formazione della mielina. La dimostrazione sperimentale dell’esistenza di una linea unica di cellule lungo il decorso dell’assone formata da astrociti, interposti a 3-4 oligodendrociti in sequenza, e la presenza di giunzioni intercellulari fra queste cellule, fanno pensare ad un network di interazione. La scoperta di un aumento del livello di GFAP (glial fibrillar acidic protein) nel corso della mielinizzazione, e la maturazione del

complesso

citoscheletrico

GFAP-vimentina

proprio

all’inizio

della

mielinizzazione, sembra confermare il ruolo degli astrociti nella formazione del rivestimento mielinico e nella sua maturazione. Poichè il processo di mielinizzazione è strettamente dipendente dalla maturazione funzionale degli oligodendrociti è utile ricordare l’insieme di fattori, in parte locali, in parte a carattere sistemico, che influenzano questo processo: a) Fattori di crescita (Growth factors):         

PDGF Basic FGF IGF I Neurotrofina-3 GGF CNTF IL6 TGF IL2

b) Neurotrasmettitori:    

Interazione fra glutammato e recettori AMPA-kainato sugli oligodendrociti Dopamina e recettori D3 GABA e recettori GABAA Oppioidi e µ-recettori in fase iniziale, κ-recettori durante la formazione della mielina

c) Gap junction fra oligodendrociti e astrociti

20

d) Fattori ormonali:   

Ormoni tiroidei GH Neurosteroidi (pregnenolone, progesterone e loro derivati solfato)

1.1 METODICHE DI BRAIN IMAGING La Risonanza magnetica (MRI), dato il suo elevato livello di sensibilità e specificità, rappresenta il primo strumento diagnostico utilizzato nella definizione e nella caratterizzazione delle leucoencefalopatie. Sono numerosi i contributi che l’introduzione della MRI ha apportato allo studio delle patologie della sostanza bianca: la possibilità di visualizzare direttamente l’aspetto morfologico globale e grossolano del danno cerebrale, nonché la possibilità di identificare il grado, la topografia e la distribuzione del coinvolgimento della sostanza bianca. La MRI, infatti, risulta estremamente sensibile nell’identificazione delle alterazioni di segnale correlate alle anomalie della mielina (ipomielinizzazione, dismielinizzazione e demielinizzazione), per quanto alcune alterazioni di segnale siano imputabili a componenti coesistenti come edema o gliosi. Alla MRI convenzionale la riduzione del contenuto mielinico e l’aumento di contenuto acquoso, che caratterizzano le leucodistrofie, determinano tipicamente un aumento dei tempi di rilassamento T1 e T2 causando rispettivamente un decremento dell’intensità di segnale (ipointensità) nelle sequenze T1 pesate ed un suo aumento in quelle T2 pesate (iperintensità). Le immagini in T1 vengono in genere utilizzate per l’identificazione più precisa delle diverse strutture anatomiche e sono più efficaci nel visualizzare piccole quantità di mielina ancora in via di formazione (mielinizzazione nel corso dello sviluppo fetale).

21

Le fibre mielinizzate appaiono, nelle immagini T1, chiare mentre il liquido cerebrospinale (CSF) risulta nero. Le sequenze T2 pesate sono invece più adatte nel visualizzare processi patologici a carico della sostanza bianca e, per pazienti di età uguale o superiore ai 9-10 mesi, più utili nello stabilire il grado di mielinizzazione. Le fibre normalmente mielinizzate appaiono, nelle immagini T2, scure mentre il CSF è chiaro. La tecnica FLAIR (Fluid attenuated inversion recovery) è una sequenza T2 in cui il segnale derivante dalla componente fluida libera, per esempio quella del CSF, è annullata. In queste immagini il CSF appare nero, mentre le fibre mielinizzate sono scure. La sostanza bianca patologica appare quindi chiara (iperintensa) e la tecnica risulta particolarmente utile soprattutto nelle lesioni periventricolari od in caso di eventuale evoluzione pre-cistica o cistica. La MRI è inoltre particolarmente efficace nel monitorare l’evoluzione del quadro clinico, le modificazioni dell’interessamento della sostanza bianca ed anche la risposta ad eventuali protocolli terapeutici. Da ultimo il pattern e le caratteristiche specifiche delle anomalie della sostanza bianca, nonché la distribuzione, la simmetria e l’evolutività del suo coinvolgimento, costituiscono presupposti fondamentali per identificare elementi caratteristici delle singole entità morbose, fornendo uno strumento semplice, ed estremamente efficace, non solo in ambito diagnostico, ma anche per una migliore categorizzazione e definizione delle diverse patologie in questione. La diffusione delle tecniche di neuroimaging, e di risonanza in particolare, ha permesso, nel tempo, di “collezionare” una quantità di reperti nettamente superiore rispetto a quanto era stato possibile con la neuroistopatologia. Le valutazioni sequenziali delle immagini MRI hanno inoltre consentito di distinguere le forme

22

progressive da quelle non progressive di malattia, e di conoscere le modificazioni del coinvolgimento della sostanza bianca dallo stadio asintomatico fino a quello avanzato. Alla MRI convenzionale, si sono succedute metodiche più elaborate per permettere uno studio migliore della composizione delle strutture cerebrali, ma anche per suggerire eventuali deficit funzionali. Il Diffusion weighted imaging (DWI) rappresenta, infatti, una tecnica di imaging a carattere funzionale che consente, su un piano cellulare, lo studio dei gradienti di diffusione all’interno dei diversi tessuti. In un mezzo omogeneo, come può essere l’acqua, il fenomeno della diffusione rappresenta il risultato di un movimento netto di molecole dovuto alla presenza di gradienti di concentrazione. Nei tessuti biologici il processo di diffusione risponde a criteri sicuramente più complessi. Al di là della presenza di gradienti di concentrazione, la diffusione dell’acqua è determinata anche dalla pressione, dalla temperatura, dalle frazioni di volume disponibili, dalla tortuosità degli spazi tissutali e dalle interazioni ioniche, per questo si parla di diffusione apparente (AD). Le immagini diffusion-weighted si basano, quindi, sul rilevamento della diffusione random (Browniana) delle molecole d’acqua (intravoxel incoherent motion) nei diversi tessuti, normale od anomala, che può essere quantizzata. Sono due le principali elaborazioni e valutazioni possibile tramite DWI : 1) la ricostruzione delle immagini in cui è eliminato l’effetto dell’anisotropia (immagini isotrope o pesate in diffusione), che vengono valutate soggettivamente, 2) la ricostruzione di mappe del coefficiente apparente di diffusione (ADC), presentate mediante regioni di interesse od istogrammi. Nel SNC infatti la diffusione delle molecole d’acqua è maggiore lungo la direzione dell’assone piuttosto che perpendicolarmente ad essa ,e per questo le molecole

23

d’acqua generano gradienti di diffusione che seguono gli assoni secondo differenti direzioni. Questo fenomeno viene denominato “anisotropia” e la sua complessità può essere espressa da una funzione matematica che viene denominata Diffusion Tensor (DT). L’anisotropia è quindi altamente influenzata, nel SNC, dalla direzione delle fibre e varia in presenza di alterazioni patologiche che interessano le stesse (demielinizzazione, perdita assonale o rimielinizzazione). Le immagini Diffusion Tensor permettono di misurare, da una parte, l’entità della diffusione delle molecole d’acqua nei tessuti tramite il valore della diffusività media (mean diffusitivity o MD) e, dall’altra, i gradienti direzionali della diffusione stessa tramite l’anisotropia frazionaria (fractional anisotropy o FA). Lo studio di DWI è quindi impostato su questi due coefficienti fondamentali: il coefficiente apparente di diffusione (ADC) e l’anisotropia frazionaria (FA). Mentre il primo parametro rileva la motilità grossolana delle molecole d’acqua nei diversi tessuti, il secondo fornisce ulteriori dati rispetto all’ampiezza dell’anisotropia di diffusione e quindi, in via indiretta, sull’integrità della mielina e della sua microstruttura cellulare. La FA, per essere analizzata, richiede però la realizzazione di immagini Diffusion Tensor (DT) ovvero l’applicazione di gradienti sensibilizzanti alla diffusione almeno secondo 6 assi di orientamento diverso. Nel SNC, in condizioni di maturità, la diffusione dell’acqua è isotropica nella sostanza grigia e marcatamente anisotropica in prossimità della sostanza bianca. L’anisotropia della sostanza bianca è il risultato della pre-mielinizzazione, e mano a mano che la mielinizzazione prosegue, l’anisotropia tende ad aumentare. A seguito di questo fenomeno, il coefficiente di diffusione apparente (ADC) tende a diminuire nella sostanza bianca, mentre aumenta l’anisotropia frazionaria (FA).

24

La disponibilità di apparecchi ad alto campo con gradienti ad elevate prestazioni, ed il miglioramento delle sequenze ad eco planare (EPI), hanno reso possibile l’acquisizione di immagini per lo studio della diffusione protonica in pochi minuti ed hanno aperto la strada allo studio ed alla caratterizzazione dei substrati patologici di diverse malattie o lesioni. Le sequenze maggioremente utilizzate per lo studio del SNC sono quelle EPI con gradienti supplementari sensibilizzati ai fenomeni di diffusione su almeno 3 assi dello spazio, come zz xx ed yy. Inoltre all’immagine acquisita con gradienti di diffusione, ne viene sempre associata una di riferimento senza gradienti di diffusione attivi (b=0), che corrisponde, appunto, all’immagine EPI pesata in T2. L’elaborazione delle informazione derivate da questa tecnica è, almeno in parte, standardizzata ed include immagini in cui è eliminata l’influenza sul contrasto sia dell’anisotropia, che delle sequenze T2 pesate. Infatti le immagini ecoplanari con tempi di rilassamento T2 particolarmente elevati, possono “contaminare” i dati della diffusione ed “emergere” rispetto al fondo, dando l’impressione di una riduzione della diffusione. Questa interferenza può essere ridotta od eliminata ricorrendo a valori di b (unità di misura convenzionale di intensità e durata dei gradienti espressa in s/mm2) molto ristretti ed a mappe dell’ADC che contengono solo valori della diffusione indipendenti da T2. Nel caso dell’immagine isotropa, invece, è necessario utilizzare i dati derivanti dai 3 altri assi supplementari che permettono di analizzare l’anisotropia frazionaria (FA), ovvero la misura del tensore di diffusione. La valutazione delle immagini isotrope e delle mappe della ADC,

MD o

FA può

essere

eseguita soggettivamente o

quantitativamente. I più recenti sviluppi della metodologia utilizzano mappe di MD ed FA analizzate mediante software quali lo Statistic Parametric Mapping, che

25

permettono analisi globali senza valutazioni a priori delle eventuali anomalie o modificazioni dei parametri. Il diffusion weighted imaging trova utili applicazioni nelle patologie congenite della sostanza bianca e nelle malattie del metabolismo, che rappresentano un capitolo estremamente ampio della patologia pediatrica. I quadri delle immagini pesate in diffusione variano in funzione dei meccanismi fisiopatologici alla base delle diverse patologie. In generale, i processi che causano la decomposizione della mielina provocano una riduzione dell’anisotropia, calcolata mediante il tensore di diffusione, ed un aumento della diffusività media legata alla maggiore componente acquosa libera in assenza di mielina. Inoltre le immagini presentano aspetti peculiari, non solo correlati al diverso tipo di patologia in analisi, ma anche al quadro evolutivo della stessa. Così, ad esempio, nella leucodistrofia metacromatica in fase attiva, le immagini in diffusione mostrano un aumento di segnale nelle zone di progressione della malattia con un pattern “tigroide” che suggerisce una riduzione della diffusione dovuta ad un edema di medio grado, mentre quando la demielinizzazione è avanzata le lesioni appaiono ipointense in accordo con una rarefazione della matrice e della sostanza bianca ed un aumento della diffusione isotropica. La Risonanza magnetica in diffusione, grazie alle sue elevate qualità tecniche, ha apportato, nello studio delle patologie della sostanza bianca, importanti contributi non solo in termini di localizzazione topografica delle lesioni, ma anche di migliore definizione del meccanismo fisiopatologico responsabile. I continui avanzamenti tecnici, sia in termini di presentazione e studio delle immagini che di risoluzione spaziale e velocità di esecuzione, fanno sperare nella possibilità di incrementare la comprensione dei meccanismi alla base delle singole malattie con la possibilità di

26

correlare i dati della genetica con le variazione morfologico-strutturali riscontrate a livello della componente mielinica cerebrale. Infine, una delle tecniche più utilizzate nello studio della biochimica e del metabolismo cerebrale, soprattutto per la sua capacità diagnostica, è la spettroscopia in risonanza magnetica (H-MRS). La H-MRS è basata sulle proprietà magnetiche dei nuclei e sul loro momento magnetico. In presenza di un forte campo magnetico, infatti, i nuclei tendono ad allinearsi secondo la direzione del campo stesso e, se ne viene applicato perpendicolarmente un secondo, sotto forma di impulso a radiofrequenza, i nuclei subiranno una deviazione che presenta uno specifico angolo di rotazione. Quando questo impulso a radiofrequenza viene annullato, i nuclei tendono a riallinearsi al campo principale secondo una frequenza specifica ed in funzione dei loro tempi di rilassamento (T1 e T2), inducendo una corrente in una bobina la cui intensità andrà riducendosi mano a mano che il reallineamento progredisce. Questa corrente indotta può essere registrata come segnale, chiamato free induction decay (FID). Il FID può essere convertito in un segnale di ampiezza variabile in funzione della frequenza che costituisce lo spettro della risonanza magnetica. In presenza di nuclei con caratteristiche differenti, oppure di nuclei identici ma differenti nella loro “organizzazione” chimico-molecolare, il segnale ovviamente cambia, consentendo di quantizzare i diversi nuclei, o combinazioni di nuclei, che partecipano alla costituzione del segnale stesso. La spettroscopia in risonanza è basata sull’acquisizione dei segnali derivanti dall’eccitazione dei nuclei di idrogeno o protoni (1H). L’utilizzo dello spettro protonico ha due grossi vantaggi: il nucleo di idrogeno è particolarmente stabile, e pressochè tutti i tessuti umani contengono elevate quantità di idrogeno. D’altro lato,

27

l’elevata intensità del segnale proveniente dall’acqua e, in molti casi, dai lipidi presenti nei tessuti, rischia di coprire quello proveniente da metaboliti oggetto dello studio spettroscopico. Esistono per questo numerose tecniche finalizzate alla riduzione dell’interferenza, basate sulla manipolazione degli impulsi a radiofrequenza e sui campi di applicazione dell’impulso stesso e, più recentemente, di procedimenti combinati fra impulsi a radiofrequenza e gradienti d’applicazione. I metodi secondo gradiente sono essenzialmente due: la tecnica single-voxel, in cui lo spettro è acquisito da un singolo volume di interesse (volume of interest o VOI), e le tecniche multivoxel, in cui gli spettri derivano da più voxel o tagli multipli (multiple voxels o multiple slices). Le due sequenze di acquisizione spettroscopica più diffuse sono lo Stimulated-Echo Acquisition Mode (STEAM) e la Point Resolved Spectroscopy (PRESS). La prima utilizza una metodica stimulated-echo secondo 3 impulsi a radiofrequenza consecutivi a 90 gradi, mentre la seconda utilizza un doppio impulso a radiofrequenza spin-echo (90°- 180° -180°). Entrambe vengono in genere utilizzate con metodica single-voxel. Difficoltà possono derivare dal fatto che lo spettro protonico è ridotto a frequenze molto vicine fra loro ed il rilevamento e la quantizzazione di specifici metaboliti potrebbe essere estremamente complicata. A questo si è ovviato con numerose metodiche come la regolazione del time echo (TE), fra long e short time, e dei tempi di ripetizione (time repetition o TR), che determinano effetti sul contenuto informativo dello studio spettroscopico. In seconda istanza lo spettro è spesso di difficile valutazione potendo contenere picchi sovrapposti, distorsioni di segnale ed effetti derivati dalla difficoltà di localizzazione precisa del voxel. Proprio per questo, più che quantizzare il valore assoluto dei picchi, si tende a rilevare il rapporto fra le quantità dei diversi metaboliti che tende, di norma,

28

a mantenersi invariato. Differentemente dalla risonanza magnetica, che utilizza i segnali per ottenere una elevata definizione anatomica, la spettroscopia quindi “sopprime” il segnale di fondo per misurare la concentrazione dei neurotrasmettitori e dei metaboliti in esso contenuti. Le sostanze che vengono comunemente misurate sono: N-acetil-aspartato (NAA), creatina/fosfocreatina (Cr), mio-inositolo (mI), glutammato/glutammina/GABA (Glx), e lattato (Lac). Ciascuno dei diversi metaboliti viene identificato dalla posizione del suo picco (chemical shift) sulle ascisse (che contiene una scala di frequenze espressa in parti per milione-ppm), mentre la sua concentrazione è calcolata in funzione dell’area compresa sotto ciascun picco (Figura 8).

a)

b)

Figura 8: Spettroscopia single-voxel della sostanza grigia (a) e della sostanza bianca (b) a livello frontale in un soggetto normale. Il picco di lattato non è rilevabile nei soggetti sani, mentre in alcune patologie neurologiche si presenta sotto forma di un doppio picco centrato sugli 1.3 ppm.

Ciascun metabolita presenta concentrazioni differenti fra sostanza grigia e sostanza bianca così come variazioni della loro concentrazione assumono diverso significato patologico. L’N-acetil-aspartato (NAA; 2,02 ppm) rappresenta il picco predominante nel tessuto cerebrale normale e, pur essendo determinato principalmente dall’NAA, include piccole quantità di N-acetil-aspartil-glutammato. Sebbene il ruolo funzionale di questo amminoacido non sia stato ancora determinato, l’NAA rappresenta un

29

possibile marker neuronale, infatti il suo picco si localizza in corrispondenza delle cellule neuronali, mentre non è rilevato nelle cellule gliali mature, nel CSF o nel sangue. Una riduzione del suo picco correla quindi con una perdita neuronale o con una loro ridotta attività funzionale. Nel picco del glutammato/glutammina/GABA (Glx; 2,3 ppm) la componente prevalente è quella relativa al glutammato ed alla glutammica, mentre il GABA tende ad essere meno visibile. Il glutammato è il neurotrasmettitore e l’amminoacido presente in maggiore quantità nel cervello umano, mentre la glutammina sembra localizzarsi a livello astrocitario e rappresenta il principale derivato del metabolismo del glutammato. Un picco particolarmente elevato del Glx nello spettro (ed in particolare del glutammato) sembra rappresentare un elemento indicante sofferenza neuronale. Il picco della Creatina/fosfocreatina (Cr; 3.02 ppm) è stato a lungo usato da molti autori come riferimento standard per l’interpretazione delle variazioni degli altri metaboliti ed è frequente in spettroscopia ritrovare ratio in cui la creatina è presente al denominatore (NA/Cr, Cho/Cr, etc.). Questo come risultato della convinzione che il picco di creatina rimane sostanzialmente stabile nella maggior parte delle malattie del SNC, anche se alcuni studi sembrano smentire questa ipotesi. La creatina, e soprattutto la fosfocreatina, che deriva dalla prima per azione della creatin chinasi, rappresenta un substrato ad alto contenuto di fosfati che riveste un ruolo determinante nel fornire energia per il mantenimento del metabolismo cellulare. Il picco di Colina (Cho; 3.23 ppm) è determinato da numerose componenti mobili fra cui predominano la fosforilcolina e la glicerofosforilcolina. Le componenti legate alla membrana non sono in genere visibili nello spettro della risonanza magnetica, così che l’alto contenuto in fosfatidilcolina delle membrane non compare. Al contrario,

30

nelle patologie che determinano un danno di membrana, la componente di colina legata alle membrane è rilasciata in forma libera, contribuendo in misura evidente all’aumento del picco; inoltre anche molti tumori cerebrali contengono elevate quantità di fosforilcolina e glicerofosforilcolina con relativo aumento del picco. Il picco del mio-inositolo (mI; 3.56 ppm) è determinato principalmente da questo metabolita ed, in piccola parte (< 5%), dalla glicina e dall’inositolo-1-fosfato. Il mioinositolo è coinvolto nella regolazione della pressione osmotica cerebrale e nel metabolismo dei fosfolipidi legati alla membrana, nonché in alcuni sistemi di segnale inter-neuronale che utilizzano il pathway dei fosfoinositidi. Alterazioni della concentrazione dell’mI riflettono alterazioni di questi stessi pathway. Il picco del lattato (Lac; 1.33 ppm) è posizionato in una parte dello spettro che risente l’interferenza di segnale derivata dai lipidi e da numerose altre macromolecole. Il lattato, che è prodotto della glicolisi anaerobia, si presenta sotto forma di un doppio picco a livello di 1.33 ppm e, di norma, non è rilevabile nei soggetti sani (concentrazione < 0.7 mM). La presenza e la rilevazione quindi dei due picchi del lattato in una regione cerebrale è in genere indice patologico e correla con una cattiva prognosi per il tessuto nel quale è identificato così che, anche in relazione alla difficoltà della sua discriminazione, deve essere sempre attentamente ricercato. Oltre ai picchi suddetti è possibile lo studio di altri metaboliti (tabella 1) La spettroscopia in risonanza magnetica si è dimostrata uno strumento utile nello studio di numerose patologie neurodegenerative ad esordio precoce ed in particolare nello studio delle leucodistrofie. Un elevato picco di Cho costituisce infatti un marker precoce di demielinizzazione e compare ancor prima che l’alterazione della sostanza bianca si rende evidente alle immagini di risonanza standard. Si riscontra, inoltre, un decremento del picco NAA, come probabile conseguenza del processo stesso di

31

demielinizzazione che porta con sé una disfunzione neuronale, e la presenza dei picchi del Lac, che, associati all’aumento del picco Cho, potrebbe essere correlata ad una gliosi reattiva ed ad alcuni metaboliti rilasciati dai macrofagi. Nell’insieme questi dati forniscono uno strumento sensibile e specifico dell’indice di demielinizzazione e compaiono in anticipo rispetto alle informazioni rilevabili mediante altre tecniche di neuroimaging.

ppm 0,9 1,14 1,25 1,34 1,48 1,9 2,02 2,05-2,5 2,4 3,03 3,22 3,36 3,43 3,55 3,9

CH alifatici (lipidi, amminoacidi, macromolecole) Propanediolo (propano-1,2-diolo, glicole propilenico CH alifatici (lipidi, amminoacidi, macromolecole) Lattato (Lac) Alanina (Ala) Acetato (Ace) Componenti N-acetilate, NAA in particolare (NAA) Glutammato e glutammina (Glx) Succinato Ch (Succ) e piruvato (Pyr) Creatina totale(Cr) Colina totale (Cho) Scillo-inositolo Glucosio Mio-inositolo (mI), Glicina (Gly) Creatina CH Tabella1. Valori normali medi di uno spettro cerebrale umano

32

1.1 1.1.0

I DISORDINI DELLA SOSTANZA BIANCA Le Leucoencefalopatie

La dicitura “disordini della sostanza bianca” (white matter disorders) o “leucoencefalopatie” è un termine generico che identifica il complesso di affezioni morbose che colpiscono la sostanza bianca, ovvero il rivestimento mielinico, e che si definiscono per contrasto alle malattie della sostanza grigia o polioencefalopatie. Alla distinzione su un piano di differente interessamento distrettuale corrisponde una contrapposizione delle manifestazioni cliniche. Se, almeno su un piano generale, le leucoencefalopatie sono dominate da disturbi motori come atassia e spasticità, mentre l’eventuale deterioramento della sfera cognitiva (quadro demenziale) compare in un secondo tempo; le polioencefalopatie si associano invece ad una sintomatologia neurologica dominata proprio dalla demenza e dall’epilessia, con interessamento solo tardivo, e non costante, delle funzioni motorie. La distinzione appare però, a distanza di tempo, se non artificiosa quantomeno imprecisa poichè molte delle leucoencefalopatie sono caratterizzate da un contemporaneo interessamento anche di zone della sostanza grigia e viceversa. Attualmente si intendono quindi per leucoencefalopatie il complesso di malattie con interessamento prevalente della sostanza bianca. Il coinvolgimento della sostanza bianca e delle cellule di supporto e formazione della mielina quindi, sebbene porti ad un risparmio di altre componenti del SNC, non preclude la possibilità di un danno o addirittura di una perdita assonale, che è, anzi, un aspetto comune in queste forme nosografiche, ed è correlato con l’entità e la permanenza del deficit neurologico. Le leucoencefalopatie vennero inizialmente distinte, sulla base di un criterio istopatologico,

in

leucoencefalopatie

demielinizzanti

(caratterizzate

da

una

distruzione del rivestimento mielinico), dismielinizzanti (centrate sul carattere 33

anomalo del contenuto mielinico) ipomielinizzanti (segnate da una ridotta produzione della mielina) e spongiformi (che si accompagnano a degenerazione cistica della mielina). Alla classificazione di ordine istopatologico si è affiancata una a carattere patogenetico. Attualmente la ripartizione prevalente nella letteratura scientifica è quella che distingue fra forme di leucoencefalopatie acquisite o connatali. Nelle prime l’interessamento mielinico è il risultato di un insulto che agisce dall’esterno in una qualsiasi delle fasi dello sviluppo della componente mielinica, nelle seconde invece il disturbo presenta carattere congenito quando non francamente ereditario, e vengono generalmente identificate con le leucodistrofie. La classificazione istopatologica non ha però perso l’interezza della sua valenza speculativa. Il carattere, la distribuzione, l’entità e la modalità di evoluzione nel tempo delle alterazioni mieliniche conservano ancor oggi una correlazione con le modalità e soprattutto con le cause dell’insulto patogeno.

1.1.1

Leucoencefalopatie acquisite:

Le leucoencefalopatie acquisite presentano carattere prevalentemente demielinizzante e si associano ad un’insorgenza tardiva, o quantomeno ritardata, rispetto alle forme connatali. Comprendono un ampio spettro di patologie caratterizzate da un incidenza nella popolazione sicuramente superiore alle leucodistrofie. La tabella 2 riassume le principali forme cliniche.

34

LEUCOENCEFALOPATIE ACQUISITE I

Disordini infiammatori non a carattere infettivo: a)

Sclerosi multipla e sue varianti

b)

Encefalomielite acuta disseminata (ADEM)

II Disordini infiammatori-infettivi: c)

Infezione congenita da CMV

d)

Panencefalite subacuta sclerosante

e)

Encefalite subacuta da HIV

f)

Encefalite subacuta da CMV

g)

Leucoencefalite multifocale progressiva

h)

Altre infezioni

III Disordini ipossico-ischemici: i) .

Arteriopatia cerebrale autosomica dominante con infarti subcorticali e leucoencefalopatia (CADASIL)

l)

Leucomalacia periventricolare

m)

Leucoencefalopatia policistica

n)

Demielinizzazione ipossico-ischemica ritardata

o)

Encefalopatia subcorticale arteriosclerotica (malattia di Biswanger)

p)

Invecchiamento

q)

Vasculite

r)

Da radiazioni

IV Post-traumatiche: s)

Edematosa

t)

Post-radiazioni

Tabella 2: Leucoencefalopatie acquisite (Materiale tratto dal World Wide Web University of Oklahoma)

35

I.

Disordini infiammatori non a carattere infettivo (immunomediate):

a) Sclerosi Multipla La Sclerosi Multipla (SM) è una malattia caratterizzata da una infiammazione cronica demielinizzante del sistema nervoso con gliosi reattiva. Descritta inizialmente da Cruveilheir nel 1835 e definita nei suoi aspetti clinici da Charcot (1868), è la malattia neurologica più frequentemente responsabile di disabilità neurologica nell’età giovanile/adulta. E’ due volte più comune nel sesso femminile, rara nella prima adolescenza, e la sua incidenza aumenta progressivamente dall’adolescenza fino ai 35 anni, per poi diminuire gradualmente. Sebbene la causa rimanga ancora oggi sconosciuta, dati di laboratorio, clinici e sperimentali fanno sì che essa venga considerata il prototipo delle malattie autoimmuni cerebrali. In un soggetto geneticamente predisposto, un evento scatenante (forse una infezione virale) determinerebbe l’attivazione dei linfociti T contro un antigene proprio della mielina. L’esistenza di una suscettibilità genetica è avvalorata da numerosi studi su gruppi etnici, clusters familiari e gemelli. Studi di linkage hanno indicato il complesso MHC sul cromosoma 6 come uno dei determinanti genici della malattia. Studi epidemiologici suggeriscono la possibilità che individui con SM siano stati esposti nell’infanzia a fattori ambientali, virali e non, e tra i molti agenti studiati vi sono il virus del morbillo, l’EBV, l’SV5, gli herpesvirus, l’HTLV e di recente la Chlamydia pneumoniae. Molte delle nostre conoscenze sull’immunologia della SM derivano da studi sperimentali sull’encefalite autoimmune sperimentale (EAS) indotta in animali di laboratorio tramite immunizzazione con omogenato mielinico o con singole frazioni proteiche (MOG, PLP). Tali proteine, una volta processate dalle cellule presentanti

36

l’antigene (APC), attivano i linfociti T CD4+ che superano la barriera ematoencefalica e migrano nel SNC. Il rilascio di citochine (IL1, IL12 e TNF-α) e Chemochine (come l’IP-10, il RANTES e il MIP-1a) pro-infiammatorie produce una cascata di fenomeni immunologici con espressione di molecole di adesione sull’endotelio dei piccoli vasi ed alterazione della permeabilità della membrana emato-encefalica. Molteplici meccanismi sono probabilmente alla base del danno mielinico e tra questi, oltre ai linfociti T ed alle “Natural Killer”, un ruolo di primo piano è svolto dagli autoanticorpi diretti contro le proteine mieliniche. Recentemente è stata dimostrata la presenza di anticorpi anti-MOG adesi alla mielina in fase di degenerazione nelle lesioni di soggetti con SM. La malattia si caratterizza per la presenza di numerose aree di demielinizzazione nella sostanza bianca, o placche, preferenzialmente distribuite intorno ai ventricoli laterali, al pavimento dell’acquedotto e al quarto ventricolo, anche se talvolta possono avere sede sottocorticale o sconfinare in parte nella sostanza grigia. Il corpo calloso, i nervi ottici, il tronco cerebrale sono costantemente interessati, così come il midollo spinale, specie nel tratto cervicale, con tratti di demielinizzazione distribuiti nelle colonne dorsali, nelle regioni subpiali ed intorno al solco anteriore. Istologicamente le placche sono rappresentate da aree di demielinizzazione con un variabile grado di infiltrazione cellulare, perdita di oligodendrociti, astrogliosi reattiva, variabile nella sua intensità a seconda della fase di evoluzione. b) Encefalomielite acuta disseminata (ADEM): E’ una sindrome a decorso monofasico secondaria ad una vaccinazione (encefalomielite post-vaccinica) oppure ad una infezione (encefalomielite postinfettiva), caratterizzata da diffuse aree perivenulari di infiammazione, edema e demielinizzazione. Ne è stata descritta anche una variante iperacuta, clinicalmente

37

tumultuosa, caratterizzata da focolai necrotico-emorragici (leucoencefalite acuta emorragica di Weston-Hurst). La forma post-vaccinica venne inizialmente descritta come una sequela della somministrazione di vaccini contro la rabbia ed il vaiolo (vaccino di Semple) e l’introduzione di vaccini preparati senza l’utilizzazione di tessuto neurale ha notevolmente diminuito la sua incidenza. La forma post-infettiva si associa frequentemente ai comuni esantemi infantili di origine virale soprattutto di eziologia varicellosa. Dati clinici, epidemiologici e sperimentali depongono per una reazione autoimmunitaria diretta contro antigeni mielinici ed a conferma di questo è stata segnalata un’aumentata risposta verso la MBP nel sangue e nel liquor dei pazienti. II.

Disordini infiammatori-infettivi:

Le leucoencefalopatie infiammatorie demielinizzanti sono un gruppo di patologie a carattere subacuto od acuto tra cui vanno annoverate l’infezione congenita da CMV (comprendente anche una variante subacuta), l’AIDS dementia complex, la panencefalite subacuta sclerosante, la leucoencefalite multifocale progressiva e l’insieme di patologie infettive del SNC associate a demielinizzazione. A seguito dell’infezione primaria (Cytomegalovirus, Virus dell’HIV nell’AIDS dementia complex, morbillivirus nella panencefalite subacuta sclerosante, virus JC nella leucoencefalite multifocale progressiva) il virus continuerebbe a replicarsi infettando gli oligodendrociti e gli astrociti con lisi cellulare massiva e demielinizzazione oppure determinerebbe un accumulo intracellulare di prodotti virali e rilascio di citochine con conseguente danno tissutale. Le manifestazioni cliniche dipendono dalle aree interessate dal processo di demielinizzazione.

38

III.

Disordini ipossico-ischemici:

Alla patologie di tipo ischemico si associano frequentemente danni agli oligodendrociti e conseguente demielinizzazione. Recenti studi in vitro hanno evidenziato che queste cellule vanno incontro ad apoptosi nel caso di insulto ischemico in seguito all’attivazione della caspasi-11, che sembra avere un ruolo critico nel dare l’avvio alla morte cellulare programmata. Inoltre, lo stress ossidativo che subiscono gli oligodendrociti in vicinanza del bordo di una lesione ischemica potrebbe essere responsabile della genesi delle lesioni della sostanza bianca. Un altro meccanismo, recentemente studiato, di relazione tra la sofferenza ischemica e il danno oligodendrocitario, è quello eccitotossico mediato dai recettori dell’AMPA-kainato come dimostrato dagli effetti protettivi derivati dal blocco di questo recettore. Queste affezioni comprendono un gruppo eterogeneo di malattie, in parte anche a carattere ereditario (CADASIL e gene Notch3), caratterizzate da infarti cerebrali lacunari e aspetto pallido della sostanza bianca cerebrale. IV.

Post-traumatiche:

Anche eventi traumatici o l’utilizzo di radiazioni si associano ad un interessamento della sostanza bianca con una fase edematosa che precede il processo di lesione del rivestimento mielinico.

1.1.2 Leucoencefalopatie connatali : le Leucodistrofie Nell’ambito delle malattie neurogenetiche, le leucodistrofie rappresentano un capitolo assai complesso, tuttora in via di definizione, e rientrano nel Registro delle Malattie Rare recentemente introdotto nel nostro paese. Alla fervente ed attiva ricerca che ha caratterizzato le singole entità morbose negli ultimi decenni si contrappone l’incompletezza di un inquadramento generale che,

39

lungi dall’avere una funzione puramente classificatoria, potrebbe fornire comunque un ottica d’insieme capace di orientare il processo diagnostico. Oltre il 50% delle leucoencefalopatie, di cui le leucodistrofie costituiscono un nucleo non trascurabile, rimane allo stato attuale non diagnosticabile ed alla difficoltà di orientamento medico si accompagna un pesante costo umano. Per leucodistrofie si intende un gruppo eterogeneo di malattie degenerative e progressive, geneticamente determinate, che colpisce in maniera preferenziale e primitiva la sostanza bianca cerebrale, includendo una vasta gamma di condizioni che si differenziano per patogenesi, caratteristiche e decorso clinico. Le leucodistrofie possono essere classificate in accordo al difetto enzimatico responsabile, qualora conosciuto (es: la leucodistrofia metacromatica è dovuta al deficit di arisulfatasi; la malattia di Krabbe al deficit di galactocerebrosidasi), oppure sulla base dell’aspetto anatomopatologico, come la presenza di cellule multinucleate, prodotti del catabolismo della mielina (metacromatici od ortocromatici), o ancora, in rapporto alla topografia e alla tipologia della degenerazione mielinica (difetto primario o secondario della mielina). Vengono, infatti, differenziate le leucodistrofie da deficit primitivo della mielina, causato o da una patologia della maturazione degli oligodendrociti, con conseguente ipomielinizzazione da ridotta produzione (come nella malattia di Pelizaeus Merzbacher), o da una mielina prodotta in maniera anomala, le cosiddette dismielizzanti, o da una perdita della mielina dovuta a degenerazione assonale (come nella malattia di Alexander), definite invece demielinizzanti; dalle leucodistrofie secondarie in cui è evidente un coinvolgimento della sostanza bianca encefalica pur non rappresentando l’aspetto unico o patogeneticamente più rilevante, come ad esempio in alcuni disturbi del metabolismo degli amminoacidi (come la fenilchetonuria, in cui inoltre l’alterazione della sostanza

40

bianca sembra essere legata più ad un effetto secondario tossico della fenilalanina cerebrale, piuttosto che ad un coinvolgimento primitivo del metabolismo della mielina) o degli acidi organici (come l’aciduria L-2-idrossiglutarica) (vedi tabella 3).

Leucodistrofie primarie con disturbo metabolico noto: Leucodistrofia Metacromatica* Malattia di Krabbe* Adrenoleucodistrofia X-linked/ Adrenomieloneuropatia* Adrenoleucodistrofia neonatale* (NALD), Sindrome di Zellweger* (ZS), Morbo di Refsum dell’infanzia (IRD). Malattia di Canavan*

Malattie da accumulo lisosomiale

Malattie perossisomiali

Leucodistrofie primarie con disturbo metabolico non conosciuto: Sindrome di Pelizaeus-Merzbacher* Leucodistrofia autosomica dominante ad esordio nell’adulto (ADLD, Pelizaeus-Merzbacher disease autosomal dominant or late-onset type, multiple sclerosis-like disorder ) Malattia di Alexander* Leucodistrofia con Vanishing White Matter (LVWM/CACH)* Leucodistrofia con megaencefalia e formazioni cistiche subcorticali* Leucoencefalopatia con cisti subcorticali senza megalencefalia Leucodistrofia cavitaria progressiva Ipomielinizzazione centrale con atrofia dei gangli della base e del cervelletto (Sindrome H-ABC) Leucoencefalopatia con interessamento del tronco encefalico e del midollo spinale con elevati livelli di lattato (LBSL) Leucoencefalopatia diffusa autosomica dominante con sferoidi neuroassonali (HDSL) Leucodistrofia associata ad alterazioni nel metabolismo dei polioli Leucodistrofia con oligodontia Malattia di Salla* Ipomielinizzazione severa associata a valori elevati di NAAG nel liquor Leucodistrofia con atassia sordità e cardiomiopatia ADCL* (ataxia deafness cardiomyopathy leukodystrophy)

continua tabella pagina seguente

41

Leucodistrofie secondarie ad alterazione metaboliche/ degenerative Fenilchetonuria Disturbo del metabolismo degli Aciduria L-2-Idrossiglutarica amminoacidi e degli acidi organici Encefalopatie mitocondriali Sindrome di Leigh Sindrome di Cockayne Leucodistrofia con calcificazioni dei gangli basali (Sindrome di AicardiGoutières) Sindrome 18q- (Sindrome di De Grouchy) Osteodisplasia policistica lipomembranosa con leucoencefalopatia sclerosante (PLSOL, Malattia di Nasu-Hakola) Sindrome di Sjögren-Larsson (SLS) Altre Tabella 3. *(marker genetico noto/o noto in alcuni casi)

Nonostante il primo importante passo nella diagnosi di queste patologie resti la valutazione clinica e radiodiagnostica, in altre parole l’associazione tra sintomi e segni di diffusa disfunzione del sistema nervoso centrale (SNC) con un quadro di alterato segnale della sostanza bianca alla risonanza magnetica (MRI), associato eventualmente ad altre metodiche di brain imaging (diffusion Weighted RM, spettroscopia RM), sempre maggior rilievo si è posto sugli studi biochimici, enzimatici, e più recentemente di analisi del DNA.

1.1.2,1 Leucodistrofie primarie con disturbo metabolico noto •

LEUCODISTROFIA METACROMATICA (MLD)

La leucodistrofia metacromatica è una malattia da accumulo lisosomiale (LSDs: lisosomal storage diseases) da interessamento del metabolismo dei glicosfingolipidi. Descritta per la prima volta da Greenfield J.G. nel 1933, la sua denominazione deriva dal fenomeno della metacromasia, evidenziabile allo studio neuropatologico, per il quale i nuclei cellulari assumono una tonalità marrone e rossastra dopo colorazione al cresil violetto ed al blu di toluidina, invece del colore blu come in condizioni normali.

42

La malattia si associa ad accumulo lipidico in diversi tipi cellulari come epatociti, cellule di Kupffer, cellule epiteliali dei dotti biliari, cellule epiteliali della vescica e cellule dell’epitelio tubulare. Nel SNC e nel SNP l’accumulo di lipidi interessa gli oligodendrociti, gli astrociti, alcuni sottotipi neuronali e le cellule del ganglio retinico. Il solfatide (galattosilceramide-3-O-solfato), responsabile della malattia, si accumula invece solo a livello cerebrale e dei nervi periferici vista la sua alta concentrazione nella mielina. La malattia comprende diversi disordini allelici autosomici recessivi, dovuti alla mutazione del gene dell’arilsulfatasi A, che comprendono, in relazione all’età d’esordio e alla sintomatologia clinica, una forma tardo infantile (esordio intorno al secondo anno di vita), una giovanile (distinta in giovanile precoce [esordio tra i 4-6 anni] e giovanile tardive [esordio oltre il sesto anno d’età]), ed una dell’età adulta (esordio dopo i 12 anni). La pseudo-deficienza di arilsulfatasi A (condizione nella quale al deficit enzimatico dell’ASA si associa assenza di sintomatologia neurologica o la presenza di sintomi diversi da quelli della leucodistrofia metacromatica) e due forme autosomiche recessive non alleliche determinate dalla mutazione dei geni della saposina B (attivatore della cerebroside sulfatasi), insieme alla sulfatidosi giovanile (deficit della multiple sulfatasi), rappresentano completano il quadro delle forme cliniche. Sebbene si tratti di una malattia a diffusione ubiquitaria, con frequenza che oscilla fra 1/40.000 ed 1/100.000 nuovi nati, sembra essere presente maggiormente nelle popolazioni di origine araba di un ristretta area della Galilea meridionale e fra gli Indiani Navajo dove raggiunge una incidenza di 1/2.520 nuovi nati con frequenza dello stato di portatore di 1/25-1/50 (Holve et al., 2001). Principali aspetti di genetica molecolare: La causa principale della leucodistrofia metacromatica è la mutazione del gene dell’arilsulfatasi A (ASA o ARSA-A)

43

localizzato sul cromosoma 22q13.31-qter costituito da 8 esoni per una lunghezza di 3 kb e che codifica per una proteina lisosomiale a funzione enzimatica di 507 aminoacidi. Sono prodotti, a partire dallo stesso gene, tre differenti mRNA con una lunghezza rispettivamente di 2.1, 3.7 e 4.8 kb e tutti e tre i trascritti codificano per una identica proteina di 507 aminoacidi, infatti differiscono fra di loro unicamente nella lunghezza della porzione 3’ non tradotta, con il trascritto di 2.1 kb che costituisce il 90% dell’mRNA totale. La proteina di 52kDa, una volta tradotta, viene trasferita nel reticolo endoplasmatico dove riceve tre oligosaccaridi che si legano a tre residui azotati e subisce la trasformazione di un residuo critico di cisteina in Cαformil-glicina e dimerizza. Il dimero viene quindi trasportato nell’apparato di Golgi dove riceve un residuo di mannosio-6-fosfato e si lega ad un recettore del residuo mannosio-6-fosfato venendo trasportata in sede endosomiale dove i complessi dissociano. Il recettore ritorna a questo punto nell’apparato di Golgi e la proteina viene trasportata in sede lisosomiale dove forma un ottamero in maniera pH dipendente. L’ASA catalizza la conversione dei solfatidi a cerebrosidi ed il suo substrato naturale è il cerebroside-3-solfato che si lega in rapporto 1:1 alla ASA insieme alla saposina B. La causa del processo di demielinizzazione, che segna questa forma di leucodistrofia, è ancora imperfettamente nota. La comprensione del meccanismo patogenetico è resa problematica dall’assenza di un modello cellulare e dalla presenza di un modello murino ARSA-deficient che presenta un quadro simile alla leucodistrofia metacromatica, ma meno grave e che non manifesta demielinizzazione cerebrale. Come in altre malattie da accumulo lisosomiale la degenerazione neuronale e gliale potrebbe essere imputata non solo all’accumulo del substrato (in questo caso il solfatide), ma anche ad anomalie metaboliche e cellulari secondarie a questo.

44

Numerose sono le ipotesi formulate nel corso degli ultimi anni e fra queste vanno annoverate quelle che concernono l’abnorme accumulo lipidico (accumulo di sulfatide e deficit di galattosilceramide, accumulo secondario di gangliosidi, deficit di colesterolo) con probabile conseguente mis-targeting delle proteine della mielina, e quelle che imputano il processo di alterazione della mielina ad un meccanismo infiammatorio, ad alterazione dei segnali calcio-dipendenti, ad un effetto tossico (in analogia alla malattia di Krabbe) derivato dall’accumulo di una sfingosina (la sulfogalattosilsfingosina) o infine ad un meccanismo apoptotico. Sono note oltre 70 mutazioni differenti del gene dell’ASA e molte di queste sono state descritte come mutazioni occasionali in singoli pazienti. Due mutazioni invece (donor mutation al passaggio fra esone 2 ed introne 2 e la sostituzione Pro426Leu) sono responsabili del 25% della totalità dei casi mentre un’altra mutazione (Ile179Ser) è responsabile di un ulteriore 5% dei casi di malattia. La recente cristallizzazione della proteina (Lukatela et al., 1998) e la definizione della sua struttura tridimensionale rappresentano un prerequisito importante per studiare a fondo gli effetti delle molteplici sostituzioni aminoacidiche sulla funzionalità enzimatica (fig.9).

Fig.9: Modello tridimensionale dell’ASA: L’arilsulfatasi presenta una zona centrale formata da 13 eliche per lo più parallele che si organizzano in una struttura a β-foglietto circondata da entrambi i lati da diverse altre eliche. Separato dal foglietto β centrale è ad esempio presente un ulteriore struttura β-ripiegata formata da quattro catene antiparallele situate perifericamente. Gli aminoacidi Asp-335 ed Arg370 formano un probabile ponte salino nelle catene β centrali e rappresentano dei residui altamente conservati all’interno di tutta la famiglia delle solfatasi e che, seppur lontane dal centro catalitico dell’enzima, rivestono estrema importanza nel mantenimento della conformazione tridimensionale della proteina (tratto da Schestag et al., 2002, NCBI database accession number 1AUK)

Pseudodeficienza di arilsulfatasi A: Gieselmann et al. (1989) hanno evidenziato 2 alleli responsabili di questa forma che determinano, nel primo caso, la perdita di un

45

segnale di poliadenilazione e, nel secondo caso, la perdita di un sito di Nglicosilazione dell’ASA. Deficit della saposina B (sphingolipid activator deficiency): Shapiro et al. (1979) e Hahn et al. (1982) descrissero per la prima volta tre pazienti affetti da leucodistrofia metacromatica con attività dell’arilsulfatasi A nella norma. Stevens et al. nel 1981 evidenziarono come, in questa forma di leucodistrofia metacromatica, l’idrolisi dei cerebrosidi solfato fosse marcatamente attenuata, ma si normalizzava, nei fibroblasti in coltura, dopo supplementazione con l’attivatore della cerebroside sulfatasi o saposina B. La saposina B fa parte di un gruppo di quattro proteine (saposina A,B,C,D) codificate dal gene della prosaposina localizzato sul cromosoma 10q21-22 che si estende per una lunghezza variabile fra le 57 ed le 1200 bp formato da 13 esoni. La regione codificante le saposine A,B e D è formata da 3 esoni, quella della saposina C da due esoni soli. La prosaposina e le quattro saposine formano dei complessi stabili con i gangliosidi e sono necessarie all’attività idrolitiche di diversi enzimi lisosomiali: la saposina A è un attivatore della glucosilceramidasi e della βgalattosilceramidasi, la saposina B è un attivatore di diversi enzimi lisosomiali fra cui la β-galattosidasi acida che idrolizza i GM1 gangliosidi, la sulfatide sulfatasi che idrolizza i solfatidi, l’α-galattosidasi e la sfingomielinasi, la saposina C è un attivatore della β-glucosilceramidasi e della galattosilceramidasi (ed il suo deficit è associato ad una variante della malattia di Gaucher come descritto da Christomanou et al, 1986), la saposina D è un attivatore della sfigomielinofosfodiesterasi. Nonostante il ruolo di attivatore delle idrolasi lisosomiali il deficit di saposina B causa un fenotipo clinico di leucodistrofia metacromatica e non quello di altre malattie da accumulo lisosomiale. Mucosulfatidosi (Deficit della multiple solfatasi): Si tratta di una variante della leucodistrofia metacromatica che combina alla leucodistrofia aspetti clinici e

46

biochimici propri delle mucopolisaccaridosi. Il gene, la cui mutazione è responsabile della malattia, è localizzato sul cromosoma 3p26 (SUMF1 o MSD) e codificherebbe per un fattore cruciale nell’attività di molte solfatasi. La malattia sarebbe determinata da un’anomalia di un processo co- o post-traduttivo che renderebbe cataliticamente attive le solfatasi. In particolare Schmidt et al. nel 1995 hanno evidenziato come un residuo di cisteina, altamente conservato in tutte le solfatasi, sia sostituito dall’acido 2-amino-3 ossipropionico mentre venga conservato nei soggetti affetti da MSD e che la mancata sostituzione possa essere la causa dell’inattività catalitica enzimatica. Manifestazioni cliniche: Il fenotipo clinico dipende dalla causa che è alla base di questa leucodistrofia: Deficit di arilsulfatasi A: In rapporto all’età di esordio ed alla progressione dei sintomi si distinguono tre forme: − Forma tardo infantile: E’ la più frequente (circa il 50% dei casi), con un incidenza di 1/40.000 nati circa. Descritta da Greenfield nel 1933, è caratterizzata da sintomi motori, rigidità, deterioramento mentale e, talvolta, convulsioni. Raramente preceduta da ritardo dello sviluppo psicomotorio, esordisce alla fine del primo o nel corso del secondo anno di vita con difficoltà alla deambulazione, cui seguono perdita della stazione eretta autonoma, disartria e, talvolta, strabismo e nistagmo. La progressione è in genere abbastanza rapida ed entro 12-24 mesi il bambino non mantiene più la posizione seduta, presenta tremore del tronco e delle mani, spesso dolore alla mobilizzazione passiva degli arti, difficoltà di alimentazione e deterioramento mentale. Durante il decorso, che può prolungarsi per alcuni anni, il bambino dimostra una iniziale tetraparesi ipotonica con riflessi profondi diminuiti o assenti e, gradualmente, una tetraparesi spastica con segni piramidali. Sono presenti macrocrania, cecità, disturbi della deglutizione e del respiro, crisi toniche

47

spontanee o provocate, crisi tonico-cloniche generalizzate ed atrofia ottica. Le funzioni mentali sono compromesse tardivamente, ma comunque con un impegno grave fino alla completa perdita di contatto con l’ambiente. − Forma giovanile: Descritta da Schutta et al. nel 1966 è meno comune della precedente, con una frequenza di 1/150.000 nati circa, ed inizia intorno ai 4-12 anni. In genere nelle forme che esordiscono intorno ai 4-6 anni i sintomi motori (disturbi della deambulazione, tremori) precedono il deterioramento mentale, mentre nelle forme ad inizio successivo avviene il contrario ed il disturbo del rendimento scolastico rappresenta il principale sintomo d’allarme. Sono frequenti le crisi convulsive ed il decorso ricalca quello della forma tardo-infantile, ma è più lento con sopravvivenza fino ai 20 anni. − Forma dell’adulto: E’ considerata molto rara, ma una estensione dell’analisi enzimatica alla popolazione adulta con patologia neurodegenerativa è senz’altro destinata ad aumentare il numero dei casi. La malattia esordisce in genere tra i 18 ed i 30 anni con difficoltà scolastiche o professionali e spesso disturbi del comportamento (turbe della sfera affettiva, della personalità, della memoria etc.) a causa dei quali viene frequentemente posta diagnosi di schizofrenia. I disturbi della coordinazione dei movimenti e le crisi convulsive, raramente sintomi iniziali, compaiono dopo un lungo periodo di latenza (anche 20 anni); segni piramidali e cerebellari sono variamente presenti, sempre associati a segni di neuropatia periferica. La variabilità fenotipica è stata correlata alla differente percentuale di attività enzimatica residua nelle tre forme. Questa interpretazione ha ricevuto conferma dall’analisi molecolare che ha identificato due specie di alleli, chiamati A ed I; l’allele A codifica per un ASA attiva ma instabile e l’allele I, invece, non dà origine a

48

proteina enzimatica. La correlazione genotipo-fenotipo ha dimostrato che i pazienti omozigoti per l’allele I, che non sono in grado di sintetizzare l’ASA, corrispondono alla forma tardo-infantile mentre i pazienti omozigoti per l’allele A, che producono un enzima instabile, corrispondono alla forma dell’adulto. I casi con la forma giovanile sono spesso composti genetici con entrambe le mutazioni. L’identificazione delle mutazioni ancora sconosciute dovrebbe completare le conoscenze sulla base molecolare dell’eterogeneicità clinica. Pseudo-deficienza di arilsulfatasi A: Si tratta di una condizione presente circa nel 2% della popolazione dovuta ad una particolare mutazione allelica che determina una ridotta attività enzimatica dell’ASA, sufficiente però per un normale catabolismo in vivo del sulfatide. Poiché il dosaggio enzimatico con un substrato artificiale, usualmente utilizzato a fini diagnostici, non consente la distinzione rispetto all’ASA residua nei soggetti affetti, la pseudodeficienza deve sempre essere tenuta presente per non incorrere in errori, soprattutto nel campo della diagnosi prenatale. Il riscontro della pseudodeficienza in soggetti con manifestazioni neurologiche differenti dalla leucodistrofia metacromatica (distonia, disartria, spasmi in torsione etc.) e, soprattutto, in pazienti psichiatrici, ha posto il problema della relazione tra bassa attività ASA e danno neurologico. Se è possibile una associazione casuale non si può però escludere un suo ruolo nel determinare o favorire i sintomi neuropsichiatrici. Forma ad esordio nell’adulto con Arilsulfatasi A nella norma: Descritta da Wright et al. nel 1988, ricalca gli aspetti clinici della forma dell’adulto di leucodistrofia metacromatica con livelli però normali di arilsulfatasi A. Sono presenti disturbi motori, urgenza ed incontinenza urinaria ed anche importante ipotensione dovuta probabilmente, in assenza di interessamento surrenalico, a neuropatia autonomica.

49

Deficit della saposina B (sphingolipid activator deficiency): Ricalca gli aspetti clinici della forma giovanile della leucodistrofia metacromatica. Mucosulfatidosi: Combina aspetti clinici e biochimici propri della leucodistrofia metacromatica e delle mucopolisaccaridosi se non addirittura, come secondo Kihara (1982), quelli clinici ed enzimatici di almeno sei diverse entità cliniche: leucodistrofia metacromatica, sindrome di Maroteaux-Lamy, ittiosi X-linked, sindrome di Hunter, sindrome di Sanfilippo tipo A e sindrome di Morquio. La malattia spesso si presenta con il fenotipo clinico della forma tardo-infantile di leucodistrofia metacromatica, con comparsa tardiva di ittiosi ed aspetti delle mucopolisaccaridosi. Sono infatti presenti quadri dismorfici (macrodattilia, disostosi multiple etc.), idrocefalo alla nascita, condrodisplasia calcificans, anomalie cardiache, anomalie tissutali esofago-laringee ed occasionalmente una sindrome emofagocitica con febbre, pancitopenia, coagulopatia, disfunzioni epatiche e proliferazione di istiociti maturi. Anatomia patologica: Gli effetti più importanti dell’accumulo di sulfatidi si manifestano a livello del SNC e del SNP dove si verifica una progressiva degenerazione delle guaine mieliniche. Dal punto di vista macroscopico, la sostanza bianca degli emisferi cerebrali e cerebellari è interessata da una demielinizzazione profonda, diffusa e simmetrica che, abitualmente, risparmia le fibre arciformi sottocorticali. Il processo patologico inizia di solito nella sostanza bianca degli emisferi in regione frontale e tende alla diffusione in direzione posteriore e caudale, differenziandosi per questo dalla forma tipica dell’adrenoleucodistrofia. Nelle fasi successive possono essere interessati anche i nuclei della base, il nucleo dentato, il tronco cerebrale ed il midollo. Istologicamente è possibile dimostrare la presenza di inclusioni lipidiche nel citoplasma dei macrofagi e delle cellule nervose ed, in particolare, delle cellule di Schwann. L’elevato numero di

50

cariche elettriche negative dei sulfatidi è responsabile della caratteristica colorazione dei preparati (metacromasia). Diagnosi: Deficit di arilsulfatasi A: Laboratorio: Dimostrazione del difetto dell’ASA nelle cellule (leucociti e fibroblasti) e dell’eccesso di sulfatide nelle urine (Austin’s test). Test prenatale di immunoprecipitazione-elettroforesi dai villi coriali. Neuroimaging: Alla TC si evidenziano aree di ipodensità diffuse, simmetriche ed a margini mal definiti, situate nella sostanza bianca periventricolare; in fase iniziale prevale l’interessamento delle regioni fronto-parietali. Coesiste una modica dilatazione dei ventricoli. Dopo somministrazione di mezzo di contrasto per via endovenosa non si dimostrano zone di enhancement. Alla MRI le aree patologiche appaiono come zone ipointense nelle sequenze T1 pesate ed iperintense in quelle T2 pesate con interessamento diffuso e simmetrico della sostanza bianca periventricolare, della corona radiata e del centro semiovale. E’ presente un coinvolgimento progressivo della sostanza bianca del cervelletto e del tronco cerebrale, della sostanza grigia profonda (talami, nuclei della base) e delle fibre arciformi sottocorticali. Assenza di enhancement periferico dopo mezzo di contrasto. La MRI si dimostra superiore alla TC nella evidenziazione del coinvolgimento dei nuclei della base e del nucleo dentato, nonché del tronco cerebrale e del midollo spinale. Alle immagini diffusion-weighted si evidenzia, in fase attiva di malattia, la presenza di iperintensità di segnale nelle zone di progressione con un pattern tipicamente “tigroide”, che suggerisce una diffusività ridotta dell’acqua probabilmente da mettere in relazione ad edema anche se le mappe ADC fanno pensare anche ad un certo grado di prevalenza del segnale T2, il che potrebbe rendere meno efficaci le immagini

51

diffusion-weighted nella diagnostica precoce. In fase più avanzata le lesioni appaiono ipointense con diffusività isotropica aumentata per perdita mielinica completa. Alla H-MRS si evidenzia una riduzione del picco NAA, un aumento del picco mI e, a volte, la comparsa del picco del lattato. Proteomi e peptidomi: Sono in corso studi per la ricerca di proteomi e petidi utili alla diagnosi biologico-biochimica di malattia Genetica: Ricerca mutazioni puntiformi e microdelezioni. Pseudo-deficienza di arilsulfatasi A: Associazione di diagnosi clinica e di laboratorio. Genetica: ricerca delle mutazioni note. Forma ad esordio nell’adulto con Arilsulfatasi A nella norma: Evidenza istologica ed autoptica di anomalie tipiche della leucodistrofia metacromatica con cromatografia su piccolo strato che rileva un aumento del sulfatide nella sostanza bianca. Mucosulfatidosi: Laboratorio: Ricerca mucopolisaccaridi acidi nelle urine con caratteristiche differenti rispetto alle mucopolisaccaridosi: eparan-solfato 39%, dermatan-solfato 21%, condroitin-solfato C 40%. Diagnosi differenziale: − Altre leucodistrofie − Disturbi di matrice psichiatrica (schizofrenia, turbe della sfera affettiva, della personalità, della memoria etc.) − Mucopolisaccaridosi ed altre malattie dismetaboliche (malattia di Hunter, malattia di Morquio, GM1 e GM2 gangliosidosi etc.) Terapia: Il trapianto di midollo è il trattamento che finora sembra aver fornito i risultati migliori arrestando temporaneamente la progressione della malattia (Bayever et al,

52

1985; Krivit et al., 1990). La sperimentazione clinica ha anche testato l’efficacia del busulfano, della vinblastina e del siero anti-timociti. Come per le altre malattie lisosomiali la terapia indicata è quella enzimatica sostitutiva (ERT, enzyme replacement therapy). Il principale problema da superare è quello del traporto dell’enzima difettivo selettivamente verso le cellule neuronali e gliali. Studi recenti su modelli murini hanno evidenziato come nel caso dell’aspartilglicosaminuria, dell’α-mannosidosi e della malattia di Krabbe l’iniezione intravenosa può già di pe sé ridurre l’accumulo di substrato. Sebbene i motivi siano ancora poco chiari è plausibile un meccanismo di uptake cerebrale parzialmente confermato nei modelli animali. L’associazione dell’iniezione intravenosa precoce con la terapia genica mediante trapianto di cellule staminali sembra relativamente promettente così come sempre più diffuse sono le terapie sperimentali di trasfezione genica tramite vettori lentivirali o di virus adeno-associati. Negli ultimi anni stanno emergendo nuove linee terapeutiche basate su un approccio cellulare che consistono nell’utilizzo di neurosfere (neurospheres or neural progenitor cells) ovvero di progenitori oligodendrogliali o neuronali preparate da embrione ed iniettate nel parenchima cerebrale. La resistenza degli oligodendrociti alla trasfezione virale e la necessità di iniezioni multiple dei precursori cellulari rappresentano i limiti principali delle due ultime tecniche prese in considerazione. Inoltre, nel 2005 (Takakusashi et al.) dimostrano un effetto additivo positivo dell’associazione della terapia genica, tramite vettore virale (AAV1), del gene dell’ARSA insieme al cDNA dell’FGE (Cα-formylglicyne-generating enzyme), che funzionerebbe da attivatore delle sulfatasi, ARSA compresa.

53



MALATTIA DI KRABBE (LEUCODISTROFIA A CELLULA GLOBOIDI)

La malattia di Krabbe, o leucodistrofia a cellule globoidi, è una malattia autosomica recessiva determinata dalla mutazione del gene della galattosilceramide-βgalattosidasi (galattocerebrosidasi, galattosilceramidasi o GALC) e rientra nella capitolo delle glicosfingolipidosi. Venne descritta per la prima volta da Krabbe nel 1916 come una nuova forma di sclerosi cerebrale diffusa. Nel 1970 il deficit della galattosilceramidasi fu identificato come il plausibile fattore causale di questa malattia, anche se il gene venne identificato solo nel 1994 (Cannizzaro et al.). Presenta una frequenza di 1/100.000-200.000 nati vivi e rappresenta un esempio di leucodistrofia ad esordio precoce, rapidamente progressiva a prognosi infausta, sebbene forme giovanili a decorso più lento siano di riscontro sempre più frequente. La malattia si presenta con manifestazioni limitate al sistema nervoso ed in particolare con l’interessamento esclusivo della sostanza bianca in quanto il galattosilceramide è assente in altri distretti corporei, con l’eccezione di una piccola quota espressa a livello renale.

Il termine “cellule globoidi” venne introdotto in seguito

all’evidenziazione della presenza di cellule appartenenti alla linea microgliale (a funzione

macrofagica)

la

cui

comparsa

è

stimolata

dall’accumulo

di

galattosilceramide non degradato che viene da esse fagocitato. Man mano che la mielinizzazione procede le cellule globoidi sostituiscono l’oligodendroglia fino ad arresto della mielinizzazione e distruzione della mielina formata.. Principali aspetti di genetica molecolare: La malattia è determinata da una mutazione del gene della GALC localizzato sul cromosoma 14q31 costituito da 17 esoni per una lunghezza di 57 kb e che contiene una regione non tradotta in 5’ ricca di residui di G e C con un potenziale elemento di legame dellaYY1 ed un potenziale sito di legame SP1. Il gene presenta un promoter in

54

posizione 176-24 upstream rispetto al codone d’inizio e due sequenze di inibizione della trascrizione, una upstream rispetto al promoter ed un’altra vicino al primo introne. Il gene codifica per una proteina enzimatica lisosomiale (669 aminoacidi) che si forma a partire da un precursore di 80kd che viene glicosilato e scisso per via proteolitica in due subunità, di 50 e 30 kD, le quali formano un complesso idrofobico ad alto peso molecolare. In conseguenza della complessità del gene e della ricchezza di sequenze inibitorie e di codoni di inizio atipici, solo una piccola quantità della proteina viene prodotta nelle singole cellule. All’interno dei disordini da accumulo lisosomiale la malattia di Krabbe presenta caratteristiche uniche dal momento che non è possibile riscontrare un accumulo di lipidi nel distretto cerebrale se si eccettuano le cellule microgliali. Gli studi biochimici dei lipidi cerebrali non hanno infatti rilevato l’aumento atteso di galattosilcerebroside, ma semmai una riduzione di cerebrosidi e sulfatidi ed una riduzione del rapporto sulfatidi/cerebrosidi. I galattocerebrosidi ed in particolare la psicosina o galattosilsfingosina, un glicolipide scisso dalla galattosilceramide-β-galattosidasi, si accumulano invece a livello microgliale e si pensa che la psicosina sia il metabolita citotossico responsabile della patogenesi della malattia (è recente l’identificazione degli effetti positivi dell’IGF I come agente antiapoptotico che contrasterebbe, nei modelli sperimentali, gli effetti tossici della psicosina, Zaka et al. 2005). La galattosilceramidasi è un enzima idrolitico lisosomiale che agisce scindendo alcuni glicolipidi dotati di una sequenza di galattosio terminale e dotati di una configurazione β anomerica, ed il suo substrato principale (galattosilceramide) è localizzato prevalentemente nella mielina. Altri substrati conosciuti

di

questo

enzima

sono

la

psicosina

(galattosilsfingosina),

il

monogalattosildigliceride ed il precursore dei seminolipidi (1-alchil-2-acil-3galattosilglicerolo). La degradazione in vivo dei substrati richiede la presenza di un

55

attivatore proteico, la saposina A, e si inserisce nella catena metabolica come da figura 10. Fig. 10: Via metabolica della galattosilceramide e dei substrati correlati: via biosintetica: la sfingosina viene acilata a ceramide, che successivamente riceve un residuo di galattosio per opera della UDP-galattosio:ceramide galattosiltransferasi, formando galattosilceramide. Lo stesso enzima può cedere un residuo di galattosio alla sfingosina formando la psicosina. Via degradativa: la galattosilceramide e la psicosina sono degradate dalla galattosilceramidasi il cui defict è responsabile della malattia di Krabbe (tratto da Suzuki K., 2003).

Il mancato accumulo di galattosilceramidi, elemento inaspettato di questa malattia lisosomiale, deve essere quindi imputato in parte alla esclusiva localizzazione di questi ultimi nella mielina ed in parte alla scomparsa delle cellule mielinizzanti distrutte nel corso della malattia (fig. 11).

Fig. 11: Meccanismo patogenetico alla base della malattia di Krabbe e motivo del mancato accumulo dei galattosilceramidi in seguito alla morte delle cellule oligodendrocitarie (tratto da Suzuki K., 2003).

Sono circa 70 le mutazioni, compresi i polimorfismi, che sono stati identificati e che sembrano interessare ciascuno dei 17 esoni del gene. Le mutazioni missense che sono responsabile della forma infantile della malattia interessano entrambe le subunità della proteina, anche se sono più frequenti nella subunità da 30kD. Una delezione di 30 kb, che compare in genere associato al polimorfismo C→T in posizione 502, è 56

responsabile del 45% delle mutazioni nella popolazione europea. Questa delezione, che inizia in corrispondenza dell’introne 10 fino alla fine del gene, originò probabilmente in Svezia con successiva diffusione in Europa ed è responsabile, in omozigosi od in eterozigosi con un’altra mutazione, anche del 35% dei casi di origine messicana. Altre tre mutazioni associate al fenotipo infantile sono responsabili di un altro 15% dei casi (C→T1538, A→C1652, 1424delA) e la mutazione G→A in posizione 809, con sostituzione di un aminoacido in posizione 270, determina, in omozigosi od in eterozigosi con la delezione di 30kb, la forma della malattia di Krabbe ad esordio tardivo. Quest’ultima appare associata al polimorfismo T→C1637, eccetto i casi di origine giapponese, ed è plausibile che non sarebbe patogena se non associata proprio all’assenza del residuo di isoleucina come da polimorfismo. Sono state identificate anche altre delezioni ed inserzioni con frame-shift o terminazione precoce del codone di lettura così come mutazioni missense in posizione 3’ con sostituzioni aminoacidiche nell’estremo carbossi-terminale della subunità da 30kD. Mutazioni uniche sono infine state identificate in particolari gruppi etnici mediorientali come i Druzi nord israeliani ed i muslim dei villaggi arabi nei pressi di Gerusalemme, che presentavano la forma infantile della malattia di Krabbe. Mutazione della saposina A: Una seconda mutazione, recentemente identificata (Spiegel et al., 2005), sembra responsabile di una forma di malattia di Krabbe determinata dalla delezione di tre basi nel gene della saposina A (per il ruolo della famiglia delle saposine vedi leucodistrofia metacromatica) che determina l’assenza di un residuo di valina in posizione 11 della proteina. La saposina A sarebbe causa di un deficit nel metabolismo della galattosilceramide che sembrerebbe confermare il ruolo di attivatori svolto dalla famiglia delle saposine.

57

Manifestazioni cliniche: Esistono due forme cliniche principali, differenziate in relazione all’età d’esordio: la forma infantile (ad esordio tra il primo ed il dodicesimo mese e che rappresenta l’8590% dei casi) e le forme ad esordio più tardivo (10-15% dei casi) che comprendono la forma tardo-infantile o giovanile precoce (ad esordio fra il primo ed il terzo anno di vita) e la forma late-onset. Forma infantile: presenta tre stadi caratteristici: Stadio I: è caratterizzato da irritabilità, stanchezza, arresto dello sviluppo mentale e motorio ed episodi di ipertermia in assenza di infezione, probabilmente determinati da interessamento dell’ipotalamo. Il bambino, normale nei primi mesi dopo la nascita, diventa progressivamente ipersensibile agli stimoli acustici, tattili o visivi e piange senza motivo. Alcuni bambini tengono una postura caratteristica con pugni serrati e appoggiati lungo i fianchi. Lieve ritardo o regressione psicomotoria, vomito e difficoltà di nutrizione portano ad una progressiva perdita di peso con aspetto emaciato. In altri casi una neuropatia periferica o la comparsa di quadri convulsivi rappresentano la modalità d’esordio della malattia in assenza di altri sintomi. La proteinorrachia è aumentata già in questo stadio. Stadio II: E’ caratterizzato da rapido deterioramento mentale e motorio con ipertonia, gambe iperestese ed incrociate, braccia flesse e capo iperesteso. Compare iper-reflessia e, meno frequentemente, epilessia tonico-clonica. Atrofia ottica e ridotta risposta pupillare agli stimoli luminosi sono frequenti, mentre la neuropatia periferica non è evidente all’esame clinico, specie se l’interessamento centrale è preponderante. Stadio III: Questo stadio viene a volte raggiunto nel giro di pochi mesi, altre volte più tardivamente, e rappresenta uno stadio pre-terminale in cui il bambino è in

58

decerbrazione, cieco, incapace del benchè minimo movimento volontario e incapace di contatti col mondo esterno. L’età media di decesso è intorno ai 13 mesi anche se alcuni pazienti muoiono precocemente intorno agli 8 mesi, per infezioni intercorrenti o difficoltà respiratorie; sono stati segnalati casi di sopravvivenza fino ai 2-3 anni. I sintomi della malattia si esprimono a livello del sistema nervoso, non è presente visceromegalia, la circonferenza cranica può essere normale o superiore alla norma e sono stati riscontrati casi di idrocefalo. In un soggetto sono state evidenziate formazioni puntiformi rosso ciliegia in sede maculare ed in un altro, la cui diagnosi venne fatta in utero, fu evidenziato uno sviluppo psicomotorio nella norma nei primi due mesi di vita con iporeflessia tendinea profonda e riduzione della velocità di conduzione a sette settimane e successivamente debolezza nucale. Forma ad esordio tardivo: I soggetti con esordio tardivo di malattia appaiono perfettamente normali fino a quando compaiono debolezza, cecità e regressione intellettiva. Il decorso clinico di queste forme è estremamente variabile. I soggetti con esordio tardo-infantile e giovanile con sintomi che compaiono dopo il primo anno di vita possono presentare alterazioni aspecifiche con difficoltà di deambulazione, cecità e perdita delle acquisizioni motorie. Nelle forme tardo-infantili (da sei mesi a tre anni) possono essere presenti, inoltre, irritabilità, regressione psicomotoria, debolezza, atassia e cecità, mentre nelle forme giovanili (da 3 a 8 anni) i pazienti sviluppano cecità con emiparesi, atassia e regressione psicomotoria con inizio rapido e decorso successivamente progressivo. Questo quadro regressivo, la cui entità è imprevedibile, determina il decesso fra i 2 ed i 7 anni dalla diagnosi. Alcuni soggetti presentano un esordio nell’adolescenza od addirittura in età adulta con perdita della destrimania,

59

parestesie alle estremità, debolezza senza impegno intellettivo, riduzione delle velocità di conduzione motorie e sensitive ed in alcuni pazienti è presente un deterioramento mentale e fisico progressivo. Le forme ad esordio nell’età adulta comprendono sia soggetti nei quali la diagnosi viene posta tardivamente, a causa dell’aspecifictà dei sintomi in fase iniziale (deambulazione incerta a base allargata, paraparesi spastica), sia casini cui l’esordio della malattia è realmente nella seconda decade di vita. Il fenotipo clinico è estremamente variabile persino all’interno di una stessa famiglia, nonostante la presenza delle medesima mutazione genica. Non è stata osservata alcuna correlazione fra età d’esordio ed attività residua della GALC, misurata nei leucociti o nei fibroblasti in coltura; esiste invece una correlazione fra il genotipo e l’età d’esordio della malattia come precedentemente illustrato nella sezione dedicata alla genetica molecolare. Anatomia patologica: L’accumulo di galattocerebroside e galattosilsfingosina determina una progressiva demielinizzazione che interessa la sostanza bianca periventricolare, il centro semiovale, la sostanza grigia pontina, il talamo, il nucleo dentato ed il cervelletto, mentre le fibre arciformi sottocorticali sono in genere risparmiate. Nelle fasi terminali della malattia predominano grave atrofia ed idrocefalo marcato, inoltre abitualmente il processo interessa anche il midollo ed i nervi periferici. Istologicamente, nelle sedi colpite dal processo patologico, è riscontrabile l’assenza pressochè totale di mielina e la sostituzione dell’oligodendroglia da parte di gliosi cicatriziale. All’interno di quest’ultima, in sede perivascolare, si ritrovano voluminosi istiociti, le “cellule globoidi”, contenenti i metaboliti in eccesso.

60

Diagnosi: Clinica: I soggetti con forma infantile sono diagnosticati sulla base dell’associazione di irritabilità, ipertonia, deterioramento neurologico progressivo, interessamento della sostanza bianca alla MRI, neuropatia periferica ed iperproteinorrachia. Nei soggetti con esordio tardivo di malattia (sei mesi-quinta decade) compaiono debolezza, cecità e regressione intellettiva. Neuroimaging: Atrofia cerebrale diffusa, simmetrica e progressiva sono caratteristici della fase avanzata di malattia. Negli stadi precoci lo studio tramite TC può essere del tutto normale e l’atrofia della sostanza bianca e grigia può comparire solo tardivamente. Sono presenti invece ipodensità della sostanza bianca, in particolare in sede parieto-occipitale, anche se questi aspetti TC possono essere comuni ad altre malattie della sostanza bianca. Lo studio MRI in genere evidenzia una demielinizzazione del cervelletto e del tronco encefalico ed è più efficace della TC nello studio dei pazienti con malattia di Krabbe anche se sono stati descritti casi di pazienti con MRI negativa e quadro TC con iperdensità del cervelletto, dei talami, del caudato, della corona radiata e del tronco encefalico. I pazienti con malattia di Krabbe e severa demielinizzazione presentano all’MRI iperintensità in T2 con perdita dell’anisotropia di diffusione e segnale elevato alle immagini diffusion-weighted ed il calcolo dei valori di T2 nella sostanza bianca centrale aiuta a definire il grado di demielinizzazione. Nei soggetti con esordio tardivo l’interessamento della sostanza bianca è localizzato prevalentemente in sede occipitale e nel centro semiovale. Alle immagini diffusion-weighted, nelle fasi precoci, si evidenzia un iperintensità di segnale lungo la linea di progressione del processo di demielinizzazione attiva probabilmente determinato da un certo grado di edema in corrispondenza del rivestimento mielinico. Nelle fasi più avanzate il segnale diventa ipointenso in seguito

61

ad una completa perdita del rivestimento mielinico con conseguente decremento dell’anisotropia ed aumento della diffusività. L’H-MRS mostra un elevato rapporto Cho/Cr, un basso rapporto NAA/Cho ed, in alcuni casi, la comparsa del picco del lattato. EEG (elettroencefalogramma): Normale in fase iniziale presenta, più tardivamente, una attività di fondo lenta e disorganizzata con alterazioni asimmetriche. EMG (elettromiografia) e NCV (velocità di conduzione nervosa): Riduzioni evidenti delle velocità di conduzione nervosa, in particolare della motoria. Test di laboratorio: Studio dell’attività enzimatica della GALC: - studio in vitro con galattocerebroside marcato effettuato in laboratori specializzati, - studio su leucociti isolati da sangue eparinizzato, - studio su fibroblasti in coltura. I pazienti affetti presentano una evidente riduzione dell’attività della GALC fino ad un livello pari allo 0-5% rispetto ai soggetti normali. La presenza di soggetti con una attività enzimatica intorno all’8-20% rispetto al normale, ma sani o con patologie neurologiche non correlabili alla malattia di Krabbe, pongono seri problemi di diagnosi differenziale (polimorfismi e mutazioni in eterozigosi sono stati riscontrati in alcuni di questi casi). Lo studio dell’attività della GALC viene effettuato anche sulle cellule dei villi coriali (10a-12a settimana) e su cellule prelevate tramite amniocentesi (15a-18a settimana) con finalità di diagnosi prenatale. Test genetico-molecolari: E’ disponibile lo studio clinico per le mutazioni da delezione di 30kb e per la mutazione puntiforme G→A809, mentre l’analisi dell’intero gene tramite sequenziamento viene effettuato a soli fini di ricerca.

62

Diagnosi differenziale: Una storia delle tappe evolutive a partire dai primi mesi di vita insieme all’analisi del deterioramento psicomotorio sono sufficienti a differenziare la malattia di Krabbe da malattie del SNC a carattere non progressivo di origine congenita o perinatale. La differenziazione invece rispetto ad altre malattie degenerative progressive è spesso difficile. Esse comprendono la leucodistrofia metacromatica, le ceroido-lipofuscinosi, la GM1 e la GM2 gangliosidosi, l’adrenoleucodistrofia X-linked, la malattia di Canavan, la malattia di Pelizaeus-Merzbacher e la malattia di Alexander. Terapia: Il trattamento dei pazienti con malattia di Krabbe ad esordio infantile ha prevalentemente carattere sintomatico con terapia di supporto per controllare l’irritabilità e la spasticità. Nelle forme infantili in assenza di sintomi ed in quelle ad esordio tardivo con impegno neurologico moderato si è tentato il trapianto di cellule staminali ematopoietiche con miglioramento del decorso ed, in alcuni casi, regressione dell’impegno neurologico, ma gli studi sugli effetti a lungo termine sono ancora in corso. Il trapianto di cellule staminali in utero è stato finora tentato tre volte con modesti risultati. Sono in corso studi su modelli animali per trattamenti alternativi come terapia genica, trapianto di cellule staminali neuronali, terapia per la riduzione dei livelli di metaboliti tossici, terapia con chaperones chimici. •

ADRENOLEUCODISTROFIA X-LINKED (X-ALD)

L’Adrenoleucodistrofia è una malattia perossisomiale causata da una mutazione di un gene legato al cromosoma X che determina un difetto nella β ossidazione lipidica con conseguente accumulo di acidi grassi saturi a catena molto lunga (VLCFA) in tutti i tessuti dell’organismo. La malattia colpisce primariamente il rivestimento mielinico del SNC, le ghiandole surrenali e le cellule di Leydig del testicolo. Descritta per la

63

prima volta nel 1910 (Haberfeld and Spieler), secondo altri nel 1913 (Schilder), venne definita nei suoi aspetti principali da Siemerling e Creutzfeld nel 1923. La malattia presenta una incidenza di circa 1,1-1,6 casi su 100.000 abitanti negli USA e 2 casi su 100.000

abitanti

in

Olanda

con

una

frequenza

della

condizione

di

eterozigosi/emizigosi pari a 1 su 16.800 abitanti. La presentazione clinica della malattia è ampiamente variabile anche all’interno di uno stesso gruppo familiare. Nei soggetti di sesso maschile sono stati descritti tre diversi fenotipi clinici: 1.

Forma cerebrale infantile (childhood cerebral form)

2.

Adrenomieloneuropatia

3.

Morbo di Addison come sola manifestazione clinica.

Nei soggetti di sesso femminile si calcola che il 10-15% delle eterozigoti possano sviluppare un quadro di adrenomieloneuropatia con paraparesi spastica a partire dalla terza fino alla quinta decade di vita. Principali aspetti di genetica molecolare: La malattia è determinata da una mutazione di un gene, l’ABCD1, localizzato sul cromosoma Xq28 costituito da 10 esoni che si estendono per circa 20 kb. Il gene codifica per una proteina, l’ALD protein (ALDP) di 745 aminoacidi che appartiene alla famiglia delle ATP binding cassette e precisamente sovrintende alla sintesi della forma 1, sottofamiglia D (Mosser et al., 1993). La proteina si aggrega in forma omodimerica e, tramite sei domini idrofobici transmembranari,

forma

un

trasportatore

di

membrana

a

localizzazione

perossisomiale. Le membrane perossisomiali presentano altri tre trasportatori ABC con notevoli analogie con l’ALDP (la PMP 70, la PMP 69 [P70R] e l’ALD-related protein [ALDR]) che possono formare eterodimeri con l’ALDP. L’ALDR in particolare (12q11) mostra circa il 66% di analogia di sequenza con l’ALDP e risulta

64

particolarmente interessante vista la capacità di sostituirsi alla ALDP nella sua attività funzionale. La principale conseguenza della mutazione sul piano biochimico è un accumulo di acidi grassi saturi a catena molto lunga (VLCFA) e in particolare degli acidi eicosaesaenoico (C26:0) e eicosatetraenoico (C24:0). Gli studi condotti agli inizi degli anni ottanta (Hashmi et al., Singh et al.) avevano fatto pensare che il deficit responsabile della malattia consistesse in una ridotta attività funzionale della lignoceroil-CoA ligasi responsabile dell’attivazione degli acidi palmitico e lignocerico; mentre alla fine degli anni ottanta si pensò ad una ridotta attività della VLCFA-CoA sintetasi per un deficit di trasporto di un suo cofattore o per una sua mancata localizzazione perossisomiale. Con la definizione del gene e l’identificazione della mutazione responsabile della malattia è stato possibile studiare la proteina che, lontano dall’avere una funzione enzimatica, svolge un ruolo di trasportatore di membrana ed è indispensabile al processo di β-ossidazione perossisomiale. La β -ossidazione degli acidi grassi si svolge con meccanismo carnitina dipendente a livello mitocondriale e con meccanismo non dipendente dalla carnitina a livello perossisomiale. L’ALDP, come trasportatore di membrana, interverrebbe facilitando l’interazione tra perossisomi e mitocondri, e nel trasporto dei VLCFA all’interno dei perossisomi. La malattia sarebbe determinata da un accumulo dei VLCFA non degradati in sede perossisomiale ed in particolare dell’acido eicosaesaenoico con effetti tossici a carico delle cellule, come dimostrato sui fibroblasti in coltura, e nella mielina stessa (Fig. 12). Recentemente si è ipotizzato che nel determinismo delle lesioni possa intervenire anche un processo di tipo autoimmune (Federico et al.) o comunque un processo infiammatorio determinato da alterazioni delle cellule microgliali, in cui la proteina è espressa, con demielinizzazione.

65

Fig. 12: Possibile meccanismo alla base della destabilizzazione della membrana mielinica determinata dall’accumulo di VLCFA nell’ALD. Come effetto dell’inefficienza del trasporto dei VLCFA in sede perossisomiale i VLCFA non vengono trasformati in acidi grassi a catena lunga e tendono ad accumularsi nella struttura bilaminare della membrana mielinica con alterazione della sua stabilità termodinamica (tratto da Barkovich AJ 2000)

Sono state identificate oltre 300 mutazioni del gene di cui il 53% sono non ricorrenti: delezioni (4%), mutazioni frame-shift (23%), mutazioni non-sense (10%), inserzioni e delezioni in-frame (5%) e mutazioni missense (59%). Circa il 70% delle mutazioni si associano ad assenza della proteina e questo avviene inspiegabilmente anche in caso di mutazioni missense. L’eterogeneità genetico-clinica di questa malattia ha inoltre portato a supporre (Maestri and Beaty, 1992) un possibile modello a due loci con la presenza di un gene modifier dominante o recessivo che giustificherebbe la diversa espressività clinica della malattia all’interno di medesimi gruppi familiari. CADDS: Sono stati descritti in letteratura (Corzo et al.) tre maschi che presentavano una mutazione della porzione 5’ del gene ABCD1, denominata CADDS (contiguous ABCD1) con un esordio precoce di una sindrome simile alla X-ALD con colestasi neonatale, ipotonia e ritardo di sviluppo. Nessuno dei pazienti presentava anomalie cranio-facciali ed i pazienti sono deceduti intorno al 1 anno di vita. I livelli dei VLCFA risultavano elevati ma gli studi sul metabolismo perossisomiale erano nella norma. Manifestazioni cliniche: La malattia è caratterizzata da un ampio spettro di manifestazioni cliniche con variazioni anche all’interno di una stessa famiglia; molti pazienti, nonostante la mutazione, rimangono asintomatici fino alla quarta decade od oltre. Sono stati riconosciuti tre fenotipi clinici:

66

Forma cerebrale infantile (35% dei soggetti affetti): La comparsa dei primi sintomi avviene intorno ai 4-8 anni con un picco ai 7 anni, anche se sono state descritte forme ad esordio più tardivo (adolescenza ed età adulta). I maschi affetti presentano all’esordio alterazioni del tono dell’umore e deficit dell’apprendimento, spesso appaiono confusi per la compresenza di deficit attentivi o per iperattività. I sintomi persistono per mesi, ed evolvono più tardi in un quadro sintomatologico particolarmente invalidante caratterizzato da deficit dell’attenzione, diminuzione delle performance scolastiche, per difficoltà nella scrittura e nella lettura, ed incomprensione del linguaggio (nonostante la componente percettiva sia integra), anomalie dell’orientamento spazio-temporale, goffaggine, incoordinazione motoria, deficit visivi fino ad occasionale diplopia, labilità emotiva ed aggressività. A volte un quadro epilettico può costituire il primo sintomo della malattia. Una volta che l’impegno neurologico si rende manifesto la patologia tende a progredire rapidamente fino a portare ad uno stato vegetativo nel giro di 1-2 anni seguito dal decesso, anche se il decorso e l’impegno clinico sono estremamente variabili. La maggior parte dei soggetti presenta un interessamento della funzione adrenocorticale che compare in genere in coincidenza con i disturbi neurologici. Adrenomieloneuropatia (40-45%): La malattia si presenta in soggetti di sesso maschile intorno ai 20-40 anni e compare sotto forma di debolezza ed affaticamento principalmente localizzato agli arti inferiori, anomalie del controllo sfinteriale e disfunzioni sessuali con ipogonadismo. I sintomi presentano carattere progressivo e circa il 40-45% dei soggetti sviluppa un interessamento cerebrale ed una sintomatologia neurologica che può variare da deficit mnesici, visivi, difficoltà di scrittura, paraparesi spastica fino ad un quadro demenziale o ad una sindrome di Balint (disordine visuospaziale con deficit di

67

fissazione, atassia ottica e paralisi psichica) che nel 10-20% dei casi porta a compromissione delle funzioni cognitive e del tono dell’umore con disabilità e morte precoce. Il 70% dei pazienti con adrenomieloneuropatia presenta compromissione adrenocorticale. Morbo di Addison come sola manifestazione clinica (10% dei soggetti affetti): I maschi affetti presentano segni di insufficienza surrenalica in alcuni casi a partire dall’età di 2 anni ma più frequentemente intorno ai 7 anni. Compaiono vomito, debolezza fino al coma con successiva diagnosi di morbo di Addison. Può essere presente iperpigmentazione cutanea da ipersecrezione di ACTH. Nel 5-10% dei maschi affetti la malattia si può presentare in forma anomala con: 1: Cefalea, aumento della pressione intracranica, emiparesi, deficit visivi, afasia. 2: Disturbo del tono dell’umore a carattere progressivo, demenza, paralisi in età adulta. 3: Incoordinazione ed atassia (bambini o adulti) 4: Vescica neurologica, anomalie della peristalsi, impotenza con o senza disturbi neurologici o endocrini. 5: Nessuna evidenza di impegno neurologico ed endocrino. Non esiste alcuna correlazione genotipo-fenotipo. Anatomia patologica: Gli organi più colpiti sono il Sistema Nervoso ed i surreni, la cui attività dipende dal metabolismo lipidico. A livello cerebrale le alterazioni vennero descritte per la prima volta da Schaumburg et al nel 1975, i quali evidenziarono aree di demielinizzazione circondate da una reazione infiammatoria che iniziava nella sostanza bianca sottocorticale posteriore per poi estendersi progressivamente in direzione anteriore. Costante è il coinvolgimento

68

delle vie acustiche ed ottiche fino ad arrivare, in sede caudale, a livello del tronco encefalico. Il processo patologico risparmia invece le fibre arciformi sottocorticali(U fibers). Sono state descritte forme atipiche d’esordio con inizio del processo in sede frontale, a livello del corpo calloso, del forceps major, della corona radiata, del tronco e dei peduncoli o con localizzazione monolaterale o con presenza di calcificazioni situate in genere in zone inattive. Nelle aree colpite sono riconoscibili tre zone: - zona1: presenza di macrofagi PAS positivi e sudanofili a distribuzione sparsa e degenerazione mielinica con risparmio assonale. Questa zona rappresenta il fronte di avanzamento del processo ed è rilevabile nella fase precoce di malattia. - zona2: adiacente alla prima, presenta frammenti residui di assoni mielinizzati e risposta infiammatoria con accumulo perivascolare di macrofagi contenenti lipidi. - zona3: la più estesa, corrisponde alla fase di inattività del processo patologico con gliosi fibrillare e proliferazione astrocitaria con scomparsa dell’oligodendroglia, degli assoni e delle guaine mieliniche. A livello surrenale si rileva atrofia della sostanza reticolare e fascicolata con presenza di cellule rigonfie e di aspetto striato in sede corticale. Diagnosi: Test di laboratorio: Dosaggio della concentrazione, nel plasma o nei fibroblasti in coltura, degli acidi grassi a catena lunga (VLCFA), dirimente nel 99,9% dei casi. I tre parametri analizzati sono la concentrazione dei C26:0, il rapporto C24:0/C22:0, il rapporto C26:0/C22:0 Valori normali 0,24+0,14 C26:0 µg/ml C24:0/C22:0 0,78+0,10 C26:0/C22:0 0,01+0,003

Maschi con X-ALD 1,30+0,45 1,71+0,23 0,07+0,03

Femmine portatrici 0,68+0,29 1,30+0,19 0,04+0,02

69

L’interessamento surrenalico (presente nel 90% delle forme con interessamento del SNC e nel 70% dei casi di adrenomieloneuropatia) può essere evidenziato tramite dosaggio dell’ACTH e della concentrazione del cortisolo dopo test di stimolo con ACTH. Neuroimaging: L’MRI presenta anomalie nella maggior parte dei soggetti con sintomatologia clinica manifesta ed evidenzia un aumento dell’intensità di segnale in T2 nelle aree parieto-occipitali con aumento del contrasto marginale. L’espressione della proteina mutata è limitata al corpo calloso, alla capsula interna ed alla commissura anteriore (dove la demielinizzazione avviene prima) per poi diffondere alla sostanza bianca occipitale ed ai tratti corticospinali (l’interessamento dei tratti corticospinali pontomidollari rappresenta un elemento peculiare di questa malattia e fornisce un criterio diagnostico di crescente interesse) e corticopontini. L’aumento del contrasto marginale è imputabile ad un effetto massa determinato dall’infiammazione e dall’edema che circonda l’area di demielinizzazione e man mano che l’infiammazione scema l’aumento del contrasto scompare con esito in atrofia localizzata. Alle immagini Diffusion weighted le tre diverse zone che caratterizzano le lesioni (area centrale completamente demielinizzata, area intermedia infiammatoria ed area esterna di demielinizzazione attiva) si dimostrano rispettivamente ipointensa, iperintensa ed lievemante ipointensa. Al Diffusion-tensor, che dimostra un alto livello di sensibilità nell’individuazione della demielinizzazione precoce, si evidenzia un incremento della diffusione isotropica ed una riduzione della FA ma in molti casi il dto presenta una certa incostanza. Nell’adrenomieloneuropatia le immagini diffusion-weighted sembrano mostrare un basso grado di demielinizzazione compatibile col decorso clinico più blando.

70

Alla H-MRS si evidenzia una riduzione del picco NAA ed un aumento del rapporto Cho/Cr ed, a volte, la comparsa del picco del lattato. L’uso di sequenze a TE basso (TE=30 ms) permette dei meglio evidenziare il picco mI. L’H-MRS si dimostra particolarmente utile nell’evidenziare e nel seguire nel tempo la progressione della malattia quando ancora la sostanza bianca appare normale all’MRI. Diagnosi clinica: Di fondamentale importanza nel distinguere le diverse sottoforme per esordio e caratteristiche cliniche. Test genetico molecolari: Sequenziamento del gene (Boehm et al. 1999) e Southern Blot per le delezioni. Diagnosi prenatale: cariotipo ed eventuale dosaggio dei VLCFA negli amniociti o nelle cellule dei villi coriali in coltura; i test genetici vengono condotti unicamente nel caso in cui il prodotto del concepimento sia di sesso maschile e sia presente la mutazione nella storia familiare. Diagnosi differenziale: Forma cerebrale infantile

Altre leucodistrofie (leucodistrofia metacromatica, leucodistrofia a cellule globoidi), encefalite subacuta sclerosante, SM, malattia di Lyme, sindrome Allgrove (acalasia, alacrimia, disturbi autonomici e morbo di Addison), altre patologie con quadro di tipo demenziale.

Adrenomieloneuropa tia

SM, paraparesi spastica progressiva, ALS, deficit di vitamina B12, tumori midollari, spondilosi cervicale

Pazienti con il solo Morbo di Addison

Tutti i pazienti con insufficienza surrenalica primitiva dovrebbero essere sottoposti a dosaggio dei VLCFA essendo la X-ALD le principale causa genetica di morbo di Addison.

Nelle altre forme sindromiche che compaiono nel 510% dei casi

A seconda della sintomatologia: – Tumori cerebrali, MELAS, CADASIL – Morbo di Alzheimer, encefalopatia tossico-alcoolica, esposizione a solventi tossici, psicosi – Degenerazione olivo-ponto-cerebellare ed altre sindromi atassiche



Altre cause di vescica neurogena, problemi intestinali ed impotenza.

71

Terapia: In caso di insufficienza surrenalica si pratica terapia sostitutiva corticosteroidea con rivalutazione periodica in assenza di impegno adrenocorticale. La terapia non ha effetti sulla sintomatologia neurologica. Terapia dietetica: La terapia con l’olio di Lorenzo (mistura di acido erucico ed oleico), per normalizzare i VLCFA, che tanta attenzione aveva provocato nell’opinione pubblica, non sembra essere in grado di arrestare la progressione della malattia. Sono in corso studi per stabilire se questa terapia sia in grado, nei soggetti con assenza di impegno neurologico, di procrastinare la comparsa o ridurre la frequenza e l’entità dei sintomi neurologici. E’ stato proposto l’utilizzo terapeutico della lovastatina e del 4-fenil butirrato, ma la loro efficacia sul piano clinico non è stata ancora completamente accertata. Trapianto di cellule staminali: E’ l’unica terapia per i soggetti con interessamento del SNC alla MRI ed i risultati sono positivi in soggetti con QI> 80. Non è risultato efficace nei soggetti senza anomalie all’MRI o con anomalie al neuroimaging in assenza di sintomi neuropsicologici o neurologici o in pazienti nei quali la compromissione intellettiva è particolarmente grave. Recentemente, in 5 pazienti, si è tentata una terapia genica con autotrapianto di cellule CD34+ corrette geneticamente tramite vettore lentivirale. Adrenoleucodistrofia pseudoneonatale Descritta per la prima volta nel 1988 (Poll-The et al.) è una sindrome clinica che ricalca l’adrenoleucodistrofia, ma che è causata da un deficit di un gene localizzato sul cromosoma 17q25 che codifica per l’Acil CoA ossidasi (ACOX1). Il gene è costituito da 14 esoni per una lunghezza di 33 kb e controlla la sintesi di un enzima, la palmitoil-CoA ossidasi, che agisce sulla β-ossidazione degli VLCFA catalizzando la

72

desaturzione degli acil CoA a trans-enoil CoA. L’ACOX cede elettroni all’ossigeno con formazione di perossido di idrogeno, marker utile nella valutazione dell’attività enzimatica. Studi col Southern blot hanno permesso di evidenziare una mutazione per delezione di 17 kb nel gene di due soggetti affetti, delezione che inizia a valle del secondo esone. Un quadro clinico e biochimico analogo deriva dal deficit di due altri enzimi perossisomiali, enzima L-bifunctional e 3-ossacil-CoA tiolasi, ma la mutazione dell’ACOX1 si associa ad un’alterazione biochimica meno severa con livelli di VLCFA più bassi, minore compromissione della β-ossidazione e dell’ α-ossidazione dell’acido pristanico. Il fenotipo clinico dei soggetti con adrenoleucodistrofia pseudoneonatale assomiglia a quello dei soggetti con ALD o a quelli con sindrome di Zellweger cerebrale o cerebroepato-renale. Il decorso sembra essere però più blando, associato in alcuni casi a quadri dismorfici (ipertelorismo, polidattilia, epicanto, orecchie ad impianto basso), grave ipotonia, leucodistrofia a partire da 2-3 anni con cecità, sordità e spasticità. Si associa ad un aumento dei VLCFA nel plasma ed i perossisomi epatici non presentano una diminuzione numerica ma sono aumentati nelle loro dimensioni con epatopatia microvescicolare ed anomalia del metabolismo degli acidi biliari. •

SINDROME

DI

ZELLWEGER

(ZS),

ADRENOLEUCODISTROFIA

NEONATALE (NALD) E MORBO DI REFSUM DELL’INFANZIA (IRD). Lo Zellweger syndrome spectrum costituisce uno spettro continuo di fenotipi clinici che comprende la sindrome di Zellweger (ZS), l’adrenoleucodistrofia neonatale (NALD) e il morbo di Refsum dell’infanzia (IRD). Tutti i disordini appartenenti allo Zellweger spectrum presentano una notevole severità clinica con un interessamento

73

diffuso a prevalente distribuzione cerebro-epato-renale, con la ZS che presenta il grado maggiore di severità e l’IRD il grado più lieve. La sindrome di Zellweger, che rappresenta il prototipo di questo gruppo di malattie, venne descritta per la prima volta nel 1960 e negli stessi anni DeDuve et al., studiando omogenati di fegato di ratto, identificarono per la prima volta i perossisomi la cui connessione con la sindrome di Zellweger divenne però evidente solo nel 1973 (Goldfisher et al.). Dieci anni più tardi gli studi permisero di chiarire il ruolo biologico dei perossisomi e, con esso, la loro importanza nel determinismo di alcune patologie nell’uomo. Dal punto di vista demografico la prevalenza dei disordini della biogenesi perossisomiale si aggira intorno ad 1 su 50.000 e nonostante si tratti di malattie a diffusione ubiquitaria sono state osservate differenze di prevalenza nelle diverse popolazioni (nei Giapponesi la prevalenza è pari a 1 su 500.000). L’insieme di queste patologie si associa ad un ampio spettro di manifestazioni morbose in cui è presente un disturbo della mielinizzazione la cui definizione necessita tuttora di ulteriori chiarimenti. Principali aspetti di genetica molecolare: Lo Zellweger spectrum è determinato dalle mutazioni di 12 geni differenti che codificano per un insieme di proteine indispensabili alla biogenesi perossisomiale, alcune delle quali sovrintendono alla formazione della membrana organocellulare, mentre altre sono implicate nel trasporto delle proteine della matrice perossisomiale. Una nomenclatura unificata è stata introdotta nel 1996 (Distel et al.): i geni responsabili sono indicati con la sigla PEX seguita da un numero progressivo, le proteine sono indicate con la dizione di percossine.

74

Simbolo del gene

Locus romosomico

Nome della proteina

PEX 1

7q21-q22

Peroxisome biogenesis factor 1

PEX10

Cr. 1

Peroxisome assembly protein 10

PEX 12

17q21.1

Peroxisome assembly protein 12

PEX13

2p15

Peroxisomal membrane protein PEX13

PEX14

1p36.2

Peroxisomal membrane protein PEX 14

PEX16

11p12-p11.2

Peroxisomal membrane protein PEX16

PEX26

22q11.2

PEX26 protein

PEX3

6q23-q24

Peroxisomal assembly protein PEX3

PEX6

6p21.1

Peroxisome assembly factor-2

PXF o PEX 19

1q22

Peroxisomal farnesylated protein

PXMP3

8q21.1

Peroxisome assembly factor-1

PXR1 o PEX5

12p13.3

Peroxisomal targeting signal 1 receptor

Si calcola che siano circa 32 le perossine implicate nella biogenesi, nella scissione e nel trasporto all’interno dei perossisomi delle proteine della matrice, tutte tappe necessarie alla formazioni di perossisomi funzionalmente competenti. Sono invece 13 le perossine (calcolando quella responsabile della RCDP) la cui mutazione è associata alle patologie che rientrano nel presente spettro morboso. All’interno dei perossisomi si svolgono processi anabolici e catabolici di notevole importanza ed in particolare la β-ossidazione degli acidi grassi (che avviene anche a livello mitocondriale) e la sintesi dei plasmalogeni. La β-ossidazione dei VLCFA a catena lineare richiede un complesso enzimatico che comprende la VLCFA-sintetasi, l’acil CoA ossidasi, la proteina D-bifunctional (enoil CoA idratasi e 3idrossiacilCoA deidrogenasi), e la β chetotiolasi perossisomiale. Tutti questi enzimi presentano la sequenza PTS1, eccetto la β chetotiolasi perossisomiale che contiene la sequenza PTS2, per il loro trasporto all’interno dei perossisomi, ed intervengono anche nella modificazione della catena

75

laterale degli acidi biliari a 27 atomi di carbonio. La sintesi dei plasmalogeni inizia nei perossisomi e procede nel reticolo endoplasmatico. A livello perossisomiale richiede l’attività di due enzimi (diidroacetone fosfato [DHAP] acil transferasi e alchil DHAP sintetasi) anche essi dotati delle sequenze PTS1 e PTS2. L’impatto delle mutazioni di geni PEX può essere studiato valutando la morfologia dei perossisomi e la loro capacità di trasporto delle proteine con sequenza PTS1 e 2 (per la PTS1 si usano anticorpi contro la catalasi o la sequenza carbossiterminale SKL per la PTS2 anticorspi contro la β chetotiolasi, la fitanoil CoA idrossilasi o l’ alchil DHAP sintetasi). I geni finora più studiati (cinque mutazioni [PEX1, PEX6, PEX26, PEX10 e PEX12]) che sono responsabili del 90% dei casi clinici presentano un ampio spettro di alterazioni che vanno dalle delezioni, alle mutazioni nonsense, alle mutazioni frameshift e a quelle puntiformi. Manifestazioni cliniche: In linea generale i disturbi che rientrano nello Zellweger spectrum si presentano nel periodo neonatale con un quadro di ipotonia (con deficit di suzione, salivazione e motilità spontanea assente), associata frequentemente a convulsioni e disfunzioni epatiche itteriche. Sono evidenti dismorfismi cranio-facciali (fronte alta, fontanella anteriore ampia, sopracciglia sottili, radice del naso allargata, epicanto, palato ogivale, micrognazia, ampiamento della cute del collo) e scheletrici (piede equino varo, contratture) con calcificazioni. Nei bambini più grandi si manifestano con atrofia ottica, sordità neurosensoriale, ipotonia e disfunzione epatica. La severità dell’interessamento visivo ed uditivo è estremamente variabile e l’impegno epatico può manifestarsi con sanguinamenti anomali da deficit dei fattori vitamina K dipendenti. E’ raro che queste condizioni morbose compaiano solamente in età adulta,

76

anche se sono stati descritti dei casi di questo tipo in letteratura con principale impegno uditivo (Moser at al. 1995). La sindrome di Zellweger in particolare si presenta in età neonatale con ipotonia, facies caratteristica, convulsioni, cisti e disfunzione epatica, condrodisplasia punctata. I pazienti giungono al decesso nei primi anni di vita per compromissioni respiratorie fino all’apnea e frequenti malattie infettive respiratorie. L’adrenoleucodistrofia neonatale ed il Morbo di Refsum dell’infanzia si presentano sin dalla nascita, ma spesso vengono diagnosticati più tardivamente in relazione al ritardo di crescita, ed alla compromissione uditiva e visiva. Presentano anche episodi emorragici fino al versamento endocranico. Il decorso è estremamente variabile, alcuni soggetti sono gravemente ipotonici, mentre altri conservano la capacità a deambulare anche in fase avanzata. La malattia ha comunque carattere progressivo e l’impegno visivo ed uditivo peggiora col passare degli anni così come il quadro leucodistrofico centrale con conseguente perdita delle abilità acquisite in precedenza. La variabilità della presentazione clinica non è correlata alla mutazione responsabile della malattia se si eccettuano le mutazioni della PEX3, della PEX16 e della PXF (PEX19) che in genere si correlano al un quadro clinicamente più severo. Non esiste inoltre nessuna correlazione tra il fenotipo biochimico e la severità della malattia anche se uno studio suggerisce che due alterazioni biochimiche (DHAP-AT e i livelli di β-ossidazione dei C26:0) correlino con la sopravvivenza nei soggetti PBD e ZSS. Una correlazione fra genotipo e fenotipo clinico e cellulare sembra però esserci se è vero che le mutazioni frame-shift sono associate ad un deficit perossisomiale più grave ed esiste una diversa severità clinica fra le diverse forme di mutazione del PEX1. Quadri analoghi allo ZS possono essere determinati da deficit enzimatici

77

isolati (vedi Pseudo-Zellweger) della β-ossidazione perossisomile (enzima D bifunctional, acil-CoA ossidasi, acetil-Coa-aciltransferasi) e vengono identificati con la sigla SED (single enzyme deficiency). Diagnosi: Test di Laboratorio: I test effettuati su sangue ed urine devono essere confermati sui fibroblasti in coltura e comprendono: dosato in:

(VLCFA) plasma

Acido fitanico ed plasma acido pristanico

valori anomali

Aumento dei C26:0, dei C26:1 e del rapporto C24/C22 e del rapporto C26/C22

Aumento dei livelli

Limiti del test Falsi positivi nei campioni non inviati per tempo al laboratorio od emolizzati, falsi positivi nei soggetti in dieta chetogenica. Falsi negativi per basse concentrazioni di HDL e LDL (C26:0 e C26:1 nella norma e rapporto C24/C22 e C26/C22 solo modestamente elevati). Valori normali nella RCDP L’aumento degli acidi grassi a catena ramificata si realizza solo con una introduzione alimentare dell’acido fitanico per cui i valori saranno normali, anche nei soggetti malati., in fase neonatale. I livelli dei plasmalogeni negli eritrociti cresce con l’età e livelli diminuiti non sono costanti alla nascita nei soggetti affetti L’escrezione di acido pipecolico È alta nel periodo neonatale e diminuisce con il passare degli anni. Il dosaggio del solo acido pipecolico non è informativo (valutare insieme a VLCFA e plasmalogeni) e può aumentare nei soggetti con epilessia piridossina dipendente e in soggetti con ritardo psicomotorio in forma isolata.

Plasmalogeni

Membrane eritrocitarie

I plasmalogeni C16 e C18 risultano diminuiti

Acido pipecolico

Plasma/ urine

L’aminoacido aumentato

Acidi biliari

Plasma/ urine

Accumulo di acido diidrossicolestanoico e Alcuni deficit sono di difficile detezione triidrossicolestanoico

risulta

Mosaicismo perossisomiale: Nella valutazione dei test di laboratorio è importante tenere in considerazione la possibilità di una condizione di mosaicismo Test genetico molecolari: Le mutazioni della PEX1 sono responsabili del 65% dei casi; quelle della PEX6, PEX26, PEX10 e PEX12 di un ulteriore 26%; quelle della PEX2, PEX3, PEX5, PEX13, PEX14, PEX16 e PEX19 di un 6%.

78

L’analisi genetica è finalizzata all’identificazione dei portatori della mutazione, alla diagnosi prenatale e alla prognosi, per quanto possibile in relazione alle correlazioni genotipo-fenotipo. Sono disponibili per uso clinico le mutazioni della PEX1 con sequenziamento dell’esone 13 e 15 (mutazioni più frequenti) e sequenziamento dell’intero gene e degli esoni ed introni della PEX2, PEX5, PEX6, PEX10 e PEX12. Gli altri geni vengono sequenziati solo con finalità di ricerca scientifica. Immunocitochimica: Lo studio immunocitochimico sui fibroblasti in coltura ha evidenziato un fenomeno noto con il termine di “sensibilità alla teperatura”, per il quale le cellule incubate a temperature più basse (30° contro 37°) presenterebbero un fenotipo funzionale meno grave. Questo fenomeno sarebbe da correlare alla conformazione più distesa delle proteine alle basse temperature e potrebbe avere un ruolo importante in relazione alla scoperta di molecole di basso peso molecolare che potrebbero, in vivo, simulare condizioni simili di temperatura. L’incubazione alle alte temperature avrebbe poi un ruolo importante nell’esacerbare i deficit funzionali così da smascherare fenotipi della malattia meno severi come in alcuni casi di mosaicismo. Diagnosi differenziale: La diagnosi differenziale varia in relazione all’età di presentazione ed agli aspetti clinici principali Forme ad esordio neonatale

Sindrome di Down, sindrome di Prader-Willi, SMA, distrofia miotonica congenita ed altre miopatie come miopatia miotubulare X-linked o miopatia multiminicore.

Forme infantili

Sindrome di Usher tipo I e II, altre sindromi con sordità neurosensoriale e retinite pigmentosa, sindrome di Cockayne, infezioni congenite, malattia di Krabbe, leucodistrofia metacromatica, malattie mitocondriali.

79

Problemi di diagnosi differenziale si pongono anche con altre malattie perossisomiali come la adrenoleucodistrofia X-linked ed il sottotipo CADDS, l’adrenoleucodistrofia pseudoneonatale. Anche in questo caso i test biochimici sono dirimenti anche se la diagnosi differenziale con la CADDS richiede lo studio dei fibroblasti in coltura. Terapia: Non esiste alcuna terapia curativa ed il trattamento di queste forme ha eminentemente carattere sintomatico essendo finalizzato al trattamento dei disturbi alimentari, della sordità, della cecità e dell’impegno neurologico ed epatico. Terapia dietetica: E’ preliminare il controllo della quantità di calorie introdotte con la dieta e, se è presente un deficit alimentare e di peso, esiste l’indicazione alla PEG. In passato era stata proposta una dieta con un basso contenuto di acido titanico, ma nessuno studio ne ha confermato l’efficacia. Sono in corso lavori per valutare l’utilità dell’uso dell’acido decaesaenoico e degli acidi biliari primari. Le funzioni visiva ed uditiva necessitano di adeguata valutazione, ed alterazioni della coagulazione da deficit dei fattori vitamina K dipendenti devono essere trattati così come quelli correlati a deficit di altre vitamine liposolubili. In presenza di disfunzione epatica bisogna trattare le complicanze (varici) ed introdurre terapia con acidi biliari primari che sembrano migliorare la funzione epatica riducendo l’accumulo di acidi colestanoici. Pseudo-Zellweger e disordini perossisomiali monoenzimatici Circa il 15% dei soggetti che presenta un fenotipo clinico compatibile con lo Zellweger spectrum e che dimostrano un livello elevato di VLCFA nel sangue, è affetto in realtà da un’alterazione della β-ossidazione perossisomiale determinata da un deficit monoenzimatico come quelli che interessano l’enzima D-bifunctional, l’acil CoA ossidasi (responsabile dell’adrenoleucodistrofia pseudo-neonatale) e la 3-

80

oxoacil-CoA tiolasi (o acetil-CoA aciltransferasi) e che vanno sotto la denominazione di sindrome pseudo-Zellweger. La β-ossidazione perossisomilale opera l’ossidazione degli acidi grassi a catena molto lunga (VLCFA) e di quelli a catena ramificata (isoprenoidi). I VLCFA, in particolare, vengono attivati attraverso la loro conversione in CoA esteri e trasportati in sede perossisomiale dalla proteina transmembrana ALD (vedi Adrenoleucodistrofia X-linked). La β-ossidazione procede quindi attraversol’attività sequenziale dell’acil-CoA-ossidasi (palmitoil-CoA-ossidasi), della proteina Dbifunctional (composta dalla enoil-CoA idratasi e dalla D-3-idrossiacil-CoA deidrogenasi) e della 3-oxoacil-CoA tiolasi. Al contrario gli acidi grassi a catena ramificata [(2S)-pristanoil-CoA e (25S)-THCA-CoA] vengono ossidati ad opera della acil CoA ossidasi a catena ramificata e della proteina di trasporto degli steroli Xtiolasi (Figura 13).

Figura13: βossidazione dei VLCFA e degli acidi grassi a catena ramificata in sede perossisomiale (tratta da Clayton, 2001).

I quadri morbosi associati ai singoli deficit enzimatici sono indistinguibili dalla sindrome di Zellweger e si presentano con l’associazione di quadri dismorfici, ipotonia, epilessia ad esordio precoce, macrocrania, leucodistrofia, retinopatia, epatomegalia fibro-steatosica, disfunzioni surrenaliche, osteoporosi ed alcuni casi di idrocefalo (vedi deficit di enoil-CoA-idratasi). I quadri clinici differiscono lievemente 81

a seconda del deficit enzimatico in causa e recentemente sono stati descritti casi di soggetti affetti da deficit del trasporto di VLCFA-CoA e di racemasi che mostrano un fenotipo clinico ad esordio tardivo dominato da deficit cognitivo nella X-ALD, e dalla retinopatia e neuropatia nel deficit di racemasi. •

MALATTIA DI CANAVAN (o ACIDURIA N-ACETILASPARTICA)

La malattia di Canavan (o malattia di Caravan-van Bogaert-Bertrand o degenerazione spongiosa del sistema nervoso centrale) è determinata dalla mutazione del gene che codifica per la aspartatoacilasi. L’eponimo deriva dalla prima descrizione neuropatologica di un caso di leucodistrofia associata a degenerazione spongiforme cerebrale effettuata da Myrtelle Canavan nel 1931 e la descrizione clinica e del modello di ereditarietà della malattia risale al lavoro di van Bogaert e Bertrand del 1949. La malattia si presentava come una associazione di macrocefalia e ritardo mentale accompagnati da degenerazione spongiforme cerebrale. Il deficit enzimatico alla base della malattia venne identificato nel 1988 e le sue basi genetico-molecolari vennero definite nel 1993 con la clonazione del gene. I casi descritti in letteratura appartengono per lo più a famiglie di ebrei polacchi (Banker et al. 1964) e caratteristica, nei casi descritti, è l’associazione di N-acetilaspartico aciduria insieme a leucodistrofia od atrofia cerebrale (Hagenfeldt et al. 1967, Kvittingen et al. 1986). Sebbene la malattia interessi tutti i gruppi etnici, la maggior parte dei casi riferiti appartengono agli ebrei Ashkenazi e gli studi di frequenza si sono così concentrati su questo gruppo etnico stabilendo una frequenza dello stato di portatore compreso fra 1/40 ed 1/58, con un rischio a priori di malattia pari a 1/6400 fino ad 1/13.456. La frequenza dello stato di portatore nella popolazione non ebrea non è noto ma sembrerebbe comunque decisamente inferiore ad 1/40.

82

Principali aspetti di genetica molecolare: La malattia è determinata da una mutazione del gene dell’aspartatoacilasi (ASPA ) localizzato sul cromosoma 17pter-p13 costituito da 6 esoni e 5 introni per una lunghezza che varia fra i 94 bp (esone III) e i 514 bp (esone VI). Il gene codifica per una proteina di 313 aminoacidi (36 kD) a funzione enzimatica, la aspartatoacilasi o aminoacilasi-2, un enzima che idrolizza l’acido N-acetil-aspartico (NAA) ad aspartato ed acetato. Il difetto biochimico responsabile del quadro clinico consiste quindi in un deficit congenito di questo enzima mitocondriale con conseguente accumulo di acido N-acetilaspatico nelle cellule nervose, nel plasma e nelle urine. L’NAA è un marker neuronale tipico del soggetto adulto alla spettroscopia in risonanza magnetica, e livelli elevati di N-acetilaspartato sono stati evidenziati anche negli oligodendrociti immaturi in coltura; questo fa pensare che un suo accumulo possa essere esso stesso alla base della fisiopatologia della malattia di Canavan. La più precoce conseguenza dell’accumulo di NAA a livello encefalico è la distruzione dei neuroni corticali, ed in particolare di quelli situati negli strati più profondi della corteccia. La fase immediatamente successiva è rappresentata dal processo di demielinizzazione delle fibre arciformi della sostanza bianca sottocorticale e coesiste pressochè costantemente l’interessamento più o meno marcato del sistema nervoso periferico. Le mutazioni del gene includono mutazioni di tipo null, con completa assenza dell’enzima, e mutazioni missense, con enzima ipoattivo e, negli ebrei Ashkenazi, uno spettro di due o tre mutazioni puntiformi (E285A, Y231X e A305E) è responsabile del 99% delle forme di eterozigosi. Manifestazioni cliniche: La maggior parte dei pazienti con malattia di Canavan non presenta disturbi nell’immediata fase post-natale. I sintomi compaiono intorno a 3-5 mesi dalla nascita

83

con mancato controllo del capo, riduzione dell’attività motoria, apatia, crisi di pianto immotivato e disturbi della suzione. Seguono un atteggiamento in iperestensione delle gambe e flessione delle braccia a tipo rigidità decorticata, spasmi in risposta a stimoli tattili o acustici e movimenti coreoatetosici alle mani ed ai piedi. Oltre il sesto mese compare un aumento della circonferenza cranica che evolve in breve in macrocrania franca. I bambini affetti presentano un ritardo che interessa in particolare le acquisizioni motorie: sono in grado di interagire, di sorridere, di raggiungere gli oggetti e sollevare la testa, quando in posizione prona, ma non sono in grado di mettersi in posizione seduta, di stare in piedi, camminare o parlare. Coesiste atrofia ottica, senza arrivare alla cecità (i bambini sono in grado di seguire gli oggetti), mentre generalmente non è presente interessamento della sfera acustica. Col passare degli anni possono comparire disturbi del sonno, convulsioni e difficoltà di alimentazione che possono richiedere il posizionamento di un tubo naso-gastrico o di una gastrostomia a permanenza. La sopravvivenza è variabile ed alcuni bambini vanno incontro a decesso nei primi anni di vita, mentre altri raggiungono l’adolescenza, a seconda del decorso clinico e dell’efficacia del controllo terapeutico. Sebbene in origine fossero state descritte tre forme differenti di malattia di Canavan in relazione all’età d’esordio (neonatale, infantile ed ad esordio tardivo), attualmente si ritiene che questa distinzione non sia valida, ma che le forme più tardive rappresentino l’evoluzione della forma infantile con una progressione benigna. Non esiste alcuna correlazione genotipo-fenotipo; ad esempio i soggetti omozigoti per mutazioni null (Y231X, 693 C→A) non possono essere distinti, sulla base del solo fenotipo clinico, da quelli con mutazioni che determinano un’attività enzimatica residua (E285A, 854A→C). Il decorso clinico della malattia non presenta quindi differenze in relazione al tipo di mutazione, né esistono diversità cliniche fra non-

84

ebrei (in cui le mtazioni più frequenti sono la A305E, 914C→A) ed ebrei e, del resto, ad uno stesso genotipo corrisponde un decorso clinico variabile. Zeng et al.(2000) hanno identificato 14 nuove mutazioni che sembrerebbero associate ad un decorso clinico più severo, ma, trattandosi di casi isolati, non è ancora possibile trarre conclusioni definitive. Anatomia patologica: A livello macroscopico, la manifestazione più precoce della malattia è la perdita della differenziazione cortico-midollare che, nelle fasi iniziali, permette di distinguerla dall’adrenoleucodistrofia. Il processo patologico può interessare anche i nervi ed i tratti ottici, il cervelletto, il tronco cerebrale, i nuclei della base ed i talami. Caratteristica pressochè costante di questa forma di leucodistrofia è la megalencefalia. Istologicamente il rilievo più importante è rappresentato da un’estesa vacuolizzazione delle fibre arciformi sottocorticali e della sostanza grigia (che si riduce progressivamente di spessore), accompagnati da un’abnorme proliferazione di astrociti di tipo II e dal riscontro di mitocondri giganti al loro interno. Sono anche caratteristiche la completa assenza di reazione flogistica e la grave atrofia e ventricolomegalia. Diagnosi: Clinica: La triade ipotonia, macrocefalia e ritardo del controllo del capo in un bambino di 3-5 mesi dovrebbero far sospettare la malattia di Canavan. Test di laboratorio: − Dosaggio del N-acetilaspartato nelle urine tramite gas-cromatografia-spettrometria di massa. La concentrazione media di NAA nei soggetti di controllo è 23.5 + 16.1 micromoli/millimoli di creatinina contro i 1440.5 + 873.3 micromoli /millimoli di creatinina nei soggetti affetti (in alcuni soggetti affetti da malattia di Canavan l’escrezione di NAA è più bassa, ma mai inferiore a 5-10 volte i valori normali).

85

− L’NAA è elevato anche nel sangue e nel CSF, ma la concentrazione urinaria è sufficiente alla diagnosi − Dosaggio dell’NAA nel liquido amniotico alla 16a-18a settimana con metodo di diluizione isotopica o GC-MS, utilizzato per la diagnosi prentale. − Test di attività enzimatica dell’aspartatoacilasi su fibroblasti in coltura (non invece effettuabile su campione di sangue o su amniociti e villi coriali) Test genetico-molecolari: Ricerca delle mutazioni più frequenti (E285A, Y231X→ 98% della popolazione ebrea e 3% non ebrei, A305E→ ∼1% ebrei, 40-60% non ebrei, 433-2A-G→ ∼1% ebrei, non disponibili i dati nei non ebrei) e analisi di sequenza per le altre forme. E’ possibile effettuare, oltre ai test per l’evidenziazione dello stato di portatore sui genitori, anche la diagnosi prenatale su DNA estratto dai villi coriali (decima-dodicesima settimana), o per amniocentesi (quindicesima-diciottesima settimana). Neuroimaging: Alterazioni dell’ecogenicità della sostanza bianca all’ultrasonografia. Alla MRI sono presenti alterazioni simmetriche diffuse (ipointense in T1 e iperintense in T2) della sostanza bianca nelle aree subcorticali cerebrali, con minore ineressamento del cervelletto e del tronco encafalico. Non è presente enhancement dopo mezzo di contrasto, mentre, con la progressione della malattia, è possibile riscontrare un quadro di atrofia. Alle immagini RM diffusion-weighted si evidenzia una iperintensità di segnale in corrispondenza delle zone interessate con un valore di ADC ridotto, compatibile con una diffusione isotropica ridotta probabilmente da correlare ad un accumulo d’acqua intramielinico o alla formazione ed accumulo d’acqua in uno strato gelificato nello spazio extracellulare.

86

Alla H-MRS è presente un picco accentuato dell’NAA, un basso rapporto Cho/Cr, un elevato rapporto mI/Cr ed, a volte, la comparsa del picco del lattato. TE di 144ms permettono di meglio quantificare l’NAA, la Cr e la Cho, mentre TE di 30ms permettono di osservare l’mI. Diagnosi differenziale:

→ Altre malattie neurodegenerative dell’infanzia come la malattia di Alexander, la malattia di Tay-Sachs, la leucodistrofia metacromatica, la glutaracidemia → Malattie con degenerazione spongiforme cerebrale come infezioni virali, malattie mitocondriali (in particolare la sindrome di Leigh) o disordini dismetabolici come la iperglicinemia non chetotica. Terapia: Il trattamento della malattia di Canavan, in assenza di una cura assoluta, ha finalità di supporto della nutrizione e dell’idratazione, e di prevenzione delle malattie infettive intercorrenti (prevalentemente respiratorie). La terapia fisica può essere utile a prevenire le contratture e migliorare le capacità motorie. Utili sono anche i percorsi terapeutici ed educativi finalizzati al miglioramento delle capacità relazionali. I soggetti

che

presentano

fenomenologia

convulsiva

richiedono

trattamento

antiepilettico ed in presenza di difficoltà di deglutizione o nutrizione è indicata una gastrostomia a permanenza per garantire un adeguato apporto nutritivo e una sufficiente idratazione. Sono in corso studi per la terapia genica effettuati dapprima su modelli animali e nel 2000 e nel 2002 (Leone et al., Janson et al.) su due bambini tramite transfezione genica con vettore non virale direttamente sulle cellule cerebrali, con risultati per ora incoraggianti.

87

1.1.2,2 Leucodistrofie primarie con disturbo metabolico non conosciuto •

SINDROME DI PELIZAEUS-MERZBACHER (PMD)

La malattia di Pelizaeus-Merzbacher è una leucodistrofia estremamente rara, trasmessa, nella maggior parte dei casi, come carattere recessivo legato al sesso e costituisce il miglior esempio di leucoencefalopatia ipomielinizzante. Descritta per la prima volta da Pelizaeus nel 1885, venne definita nei suoi aspetti patologici e clinici da Merzbacher nel 1910. Comprende un ampio spettro di affezioni morbose (PLP1related disorders) che vanno dalla malattia di Pelizaeus-Merzbacher classica (PMD) fino alla paraplegia spastica tipo 2 (SPG2), i due estremi fenotipici della medesima malattia. La patologia è causata dalla mutazione del gene della proteina proteolipidica (PLP1) con disordine della mielinizzazione del SNC (Inoue et al., 1999). Oltre ai disturbi allelici della malattia di Pelizaeus-Merzbacher nel 1984 è stata descritta una forma di malattia a trasmissione autosomica dominante ad esordio nell’età adulta (vedi ADLD, malattia Pelizaeus-Merzbacher autosomica dominante o ad esordio tardivo, multiple sclerosis-like disorder) e nel 2004 ne è stata identificata una variante ad ereditarietà autosomica recessiva (malattia Pelizaeus-Merzbacher-like o PMLD, PMLDAR) a conferma dell’ampia eterogeneicità genetica e clinica di questa patologia. La malattia ha una frequenza bassa con valori che negli Stati Uniti sono pari ad 1/300.000 fino ad 1/500.000 nati vivi ed un recente studio effettuato in Germania ha evidenziato una incidenza pari a 0,13 casi su 100.000 nati vivi (Heim et al., 1997). Principali aspetti di genetica molecolare: La forma più diffusa di malatta di Pelizaeus-Merzbacher è determinata da una mutazione del gene della proteina proteolipidica 1 (PLP1) localizzato sul cromosoma Xq22 costituito da 7 esoni per una lunghezza di 15 kb. La PLP1 è una proteina di 276

88

aminoacidi che costituisce la componente proteica predominante nel rivestimento mielinico a livello del SNC, rappresentando oltre il 50% del suo contenuto proteico. La proteina si lega tramite legame covalente agli acidi grassi e si pensa abbia un ruolo nel cementare le spirali adiacenti del rivestimento mielinico, ma è possibile che ricopra anche altre attività funzionali (vedi capitolo 1). In aggiunta alla PLP1 il gene codifica per un’altra proteina, la DM20, che rappresenta il prodotto di uno splicing alternativo in corrispondenza della metà 3’ dell’esone 3 che viene deleta con perdita della sequenza in-frame e dei corrispondenti aminoacidi 116-150. Oltre ai numerosi polimorfismi benigni, sono state identificate oltre 100 mutazioni del gene responsabili della malattia. La mutazione più frequente consiste in una duplicazione, probabilmente una duplicazione in tandem, che avviene per ricombinazione intracromosomica nel corso della meiosi maschile. Il punto di rottura della duplicazione spesso varia all’interno delle famiglie e, almeno in tre casi, è stata descritta l’inserzione del tratto duplicato in un locus differente del cromosoma X. Altre mutazioni frequenti sono: delezione da appaiamento non omologo, duplicazione invertita, mutazioni missense ed altre piccole mutazioni con alterazione della struttura tridimensionale delle due proteine. E’ stata, inoltre, individuata anche una forma di triplicazione del gene. Queste proteine anomale sembrerebbero non progredire nel processo di rimaneggiamento intracellulare e tenderebbero ad accumularsi nel reticolo endoplasmatico senza riuscire a raggiungere la membrana cellulare. Quando gli oligodendrociti iniziano il processo di mielinizzazione la malattia determinerebbe un’alterazione della mielina attraverso almeno tre meccanismi differenti che sono alla base della diversità fenotipica della malattia (Figura14).

89

Figura 14:: Meccanismo patogenetico alla base dei PLP-related disorders: Il diverso aspetto fenotipico della malattia di Pelizaeus−Merzbacher e della paraplegia spatica tipo 2 è in parte attribuibile a tre differenti meccanismi patogenetici. Nel caso della risposta all'accumulo di proteina unfolded le mutazioni puntiformi determinano un accumulo endoplasmatico di proteina nella forma "distesa" che, in taluni casi, determinerebbe la morte cellulare per apoptosi mentre, in casi meno severi, determinerebbe la presenza di una proteina proteolipidica anomala che non sarebbe in grado di legare le spirali mieliniche adiacenti. Nell'alterazione dell'assemblaggio della proteina nel Golgi la sovraespressione di proteina normale in seguito a duplicazione del gene, anomalia fra le piú frequenti, altererebbe una fase biosintetica critica che avviene nel complesso di Golgi con accumulo di PLP, galattocerebrosidi e colesterolo evidenziabili nei lisosomi e nelle vescicole endosomiali e alterazione della mielina per sbilanciamento in questi suoi due ultimi costituenti. In caso di delezione del gene della PLP o di mutazioni null, infine, la mielina sarebbe priva della proteina proteolipidica con alterato compattamento delle guaine ed alterazione della interazione della mielina con la fibra assonale (tratto da L. D. Hudson, 2003).

Uno studio sul traffico intracellulare della proteina PLP in un paziente con una nuova mutazione dell’esone 4 del gene (485G→T), associata ad un fenotipo clinico meno severo (Koizume et al. 2006[109]), ha evidenziato un accumulo della PLP all’interno del solo involucro nucleare. Questo sembrerebbe confermare la possibile correlazione dell’accumulo della proteina mutata nel reticolo endoplasmatico quale base patogenetica della malattia nella sua variante più severa. Forme alleliche: Sono state descritte in letteratura diverse forme alleliche di malattia di Pelizaeus-Merzbacher per le quali sono ancora in corso studi di genetica

90

molecolare. Cassidy et al. (1987) hanno introdotto per questo motivo il termine di malattia di Pelizaeus-Merzbacher tipo I per riferirsi alla forma classica della malattia ed il termine di forma connatale di Seitelberger (Seitelberger et al. 1954) o tipo II per riferirsi alle forme X-linked alleliche. Iwaki et al. nel 1993 hanno descritto una forma di mutazione missense della PLP che si associa alla forma connatale di PMD. Malattia Pelizaeus-Merzbacher-like o PMLD, PMLDAR: E’ una malattia autosomica recessiva determinata da una mutazione del gene della proteina gap junction α12 (connexina 46.6 o GJA12) localizzato sul cromosoma 1q41-q42 composta da un solo esone. Le gap junction comprendono un’ampia famiglia di connessine omologhe che presentano 4 domini transmembrana, due domini extracellulari e tre domini citoplasmatici (Figura 15). Presentano una larga diffusione tissutale e ciascun distretto ne esprime più sottotipi differenti. Partecipano alla costituzione di canali omo od eteromerici ciascuno costitutito dall’aggregazione di 6 connessine nella formazione di un connexone. Due connexoni attraversano ciascuno la membrana plasmatica di due cellule adiacenti con funzione di interconnessione cellulare permettendo così lo scambio di molecole di piccole dimensioni, secondi messaggeri e ioni fra le due cellule. La comunicazione intercellulare mediata dalle gap junction ha differenti funzioni a seconda dei distretti tissutali e molte malattie neurologiche, come la displasia oculodentodigitale, la Charcot Marie Tooth type 1 (CMTX1 e mutazione della gap junction protein β1 o GJB1), e forme eterogenee di sordità neurosensoriale, sono associate alle mutazioni dei geni che codificano per alcuni dei membri della famiglia delle gap junction. Gli studi su modelli animali hanno permesso di evidenziare un meccanismo patogeno diverso da una semplice perdita della funzione della GJA12 e si ipotizza un meccanismo da guadagno di funzione con effetti tossici sugli oligodendrociti. Le

91

analogie fra GJA12 e GJB1 e la loro ridondanza di espressione a livello cellulare fanno pensare che le connexine mutate possano avere funzioni inibitorie nei confronti delle altre connexine wild type. Figura 15: Domini strutturali della GJA12. I circoli in neretto indicano la localizzazione delle mutazioni. Le mutazioni missense sono localizzate tra il secondo (P90S), il quarto (Y272D) dominio transmembrana e il terzo (M286T) dominio citoplasmatico (tratta da Uhlenberg et al., 2004)

Manifestazioni cliniche: La malattia si manifesta con un ampio spettro di fenotipi clinici che comprendono: − PMD connatale o neonatale: E’ la forma più severa di malattia, esordisce alla nascita o nelle prime settimane di vita con nistagmo, ipotonia, stridore laringeo, convulsioni e deficit motori. Più tardi possono rendersi evidenti bassa statura e riduzione dell’aumento ponderale mentre l’ipotonia evolve in spasticità. I bambini affetti non sono in grado di camminare nè di utilizzare correttamente gli arti ed il cingolo superiore. L’espressione verbale è profondamente limitata, ma la comprensione è per lo più integra. Le difficoltà di deglutizione spesso richiedono l’utilizzo della nutrizione artificiale ed i pazienti muoiono durante l’età infantile per polmoniti ab ingestis anche se cure attente possono portare ad una sopravvivenza fino alla terza decade od oltre. − PMD classica: Si manifesta nei primi mesi di vita con nistagmo ed ipotonia, seguita da ritardo psicomotorio, paraplegia spastica fino alla quadripartesi, intorno al quinto anno di vita, ed atassia cerebellare con tremore della testa e del collo. I

92

pazienti possono acquisire in età scolare la deambulazione con uso di tutori che è tuttavia perduta nell’adolescenza a causa dell’aumento della spasticità. Il controllo volontario delle braccia è spesso discreto, possono comparire disturbi extrapiramidali come atetosi e distonie. Le funzioni cognitive sono meno compromesse di quelle motorie ed i pazienti sono in grado di parlare. La sopravvivenza è prolungata in genere fino alla quarta decade, ma sono stati descritti casi di sopravvivenza fino alla sesta e settima decade. − PMD transizionale: ha età d’esordio e severità sintomatica intermedia fra la forma connatale e la forma classica. − Sindrome PLP1-null: E’ così chiamata perché determinata dalla delezione del gene della PLP, si distingue per l’assenza di nistagmo ed un quadro di quadriparesi spastica meno severo con interessamento prevalentemente degli arti inferiori, atassia e neuropatia demielinizzante periferica. I pazienti PMD null cammninano meglio degli altri pazienti con malattie di Pelizaeus-Merzbacher ma sono gli unici a sviluppare la neuropatia periferica. − Paraparesi spastica non complicata (SPG2): Non si accompagna a sintomi a carico del SNC, ma può presentare talvolta disfunzioni del sistema nervoso autonomo come spasticità della muscolatura vescicale. I soggetti hanno una normale sopravvivenza. − Paraparesi spastica complicata: L’interessamento del Sistema Nervoso, da cui deriva il termine “complicata”, determina disfunzioni autonomiche, atassia e nistagmo. La diagnosi differenziale rispetto alle forme meno severe di PMD come la PMD null spesso risulta difficile. Femmine eterozigoti: Le pazienti eterozigoti possono o meno manifestare sintomi ed è stata evidenziata una relazione inversa fra la severità delle manifestazioni cliniche dei

93

maschi della famiglia e la possibilità che le femmine portatrici presentino sintomi di impegno neurologico. Le femmine sintomatiche sono quindi presenti per lo più in famiglie con forme meno severe di malattia e questo fenomeno è in parte spiegabile con il processo di inattivazione casuale della X (lyonizzazione) per il quale in presenza di una mutazione grave del gene sulla X non lyonizzata si determinerebbe apoptosi degli oligodendrociti senza comparsa della sintomatologia, mentre nelle forme di mutazione meno severe l’anomalia oligodendrocitaria persisterebbe senza morte della cellula, ma con effetti clinici manifesti. Esiste una dimostrata correlazione genotipo-fenotipo: le duplicazioni sono a causa della PMD classica (anche se variazioni nella localizzazione del punto di rottura e nei siti di reinserzione possono determinare variabilità del fenotipo), le mutazioni missense determinano le forme più severe di malattia e le mutazioni con sostituzione aminoacidica provocano la paraplegia spastica. Forme alleliche: Si manifestano nel periodo neonatale con vomito progressivo, artrogripposi multipla congenita e morte precoce a distanza spesso di pochi giorni di vita. Malattia Pelizaeus-Merzbacher-like o PMLD, PMLDAR: Presenta i sintomi clinici caratteristici delle malattie leucodistrofiche ipomielinizzanti come nistagmo, compromissione dello sviluppo motorio, segni extrapiramidali come movimenti coreoatetosici, disartria e spasticità progressiva. Nistagmo e cattivo controllo del tronco e della testa compaiono nella prima infanzia e dall’età di 8-15 anni si rende evidente il deficit di sviluppo motorio. Solo un paziente è stato in grado di camminare all’età di 5 anni, e molte dei soggetti affetti hanno presentato episodi convulsivi prima dell’adolescenza. Sono presenti una neuropatia periferica non severa, con velocità di conduzione sensitive e motorie alterate.

94

Anatomia patologica: Nelle zone colpite si evidenzia una demielinizzazione di aspetto caratteristicamente “tigroide”, associata a severa atrofia. Istologicamente, nel tessuto encefalico, oltre all’assenza pressochè completa delle guaine mieliniche ed ad un aumento del fluido interstiziale, sono riscontrabili infiltrati di macrofagi ed astrociti. Esiste inoltre una riduzione diffusa del contenuto in lipidi ed in particolare degli acidi grassi a catena molto lunga. Diagnosi: Clinica: Nonostante la variabilità del fenotipo clinico all’interno di una stessa famiglia le manifestazioni sintomatologiche sono suggestive. Boulloche et al. (1986), Hodes et al. (1993) e Cailloux et al. (2000) hanno riassunto le caratteristiche cliniche dei soggetti da loro studiati e fornito un modello schematico delle differenti manifestazioni sindromiche (tabella 4):

Fenotipo

Età d’esordio

Principali sintomi neurologici −

PMD connatale

periodo neonatale

− − − − −



− PMD classica

primi 5 anni di vita

− − − −

Capacità di deambulazione

Linguaggio

Sopravvivenza

nistagmo alla nascita stridore laringeo ipotonia spasticità severa + crisi convulsive interessamento cognitivo

mai conseguita

assente, comunicazione non verbale

fino al massimo alla terza decade

nistagmo nei primi due mesi di vita ipotonia in fase iniziale quadriparesi spastica atassia + distonia e coreoatetosi interessamento cognitivo

se raggiunta necessitano assistenza; persa comunque nell’adolescenza

normalmente presente

fino alla terzasettima decade

95

− − Sindrome PLP-null

1-5 anni

− − −

Paraplegia spastica complicata (SPG2)

− − − 1-5 anni

− −

− Paraplegia spastica non complicata (SPG2)

− 1-5 anni −

assenza di nistagmo quadriparesi spastica non severa atassia neuropatia periferica interessamento cognitivo moderato

presente

Presente, ma peggiora dopo l’adolescenza

fino alla quintasettima decade

nistagmo atassia disfunzioni autonomiche andatura spastica interessamento cognitivo assente o blando

presente

presente

normale

disfunzioni autonomiche andatura spastica interessamento cognitivo assente

presente

presente

normale

Tabella 4

Neuroimaging: Alla TC è stata descritta la presenza di un’ipodensità diffusa e simmetrica della sostanza bianca degli emisferi cerebrali e cerebellari; meno frequente sembra essere il riscontro, nelle stesse sedi, di ipodensità multiple e distinte. Si rileva diffusa atrofia ed assente enhancement dopo mezzo di contrasto. Alla MRI è evidente un marcato prolungamento dei tempi di rilassamento T1 e T2 responsabile di un’iperintensità diffusa e simmetrica in T2 a livello della sostanza bianca periventricolare, degli emisferi cerebrali e cerebellari e del tronco cerebrale nonché della sostanza grigia profonda dei nuclei della base e dei talami. Nella maggioranza dei bambini la sostanza bianca è ridotta in volume ed è evidente una riduzione dello spessore del corpo calloso. Dal momento che la mielinizzazione si realizza nei primi anni di vita, le immagini T2 pesate possono non essere utili nella dimostrazione delle anomalie fino al primo/secondo anno di vita. E’ presente diffusa atrofia.

96

In uno studio condotto nel 1999 Takanashi et al. hanno messo in evidenza una differenza tra le e forme dovute a mutazioni puntiformi e le forme classiche di PMD, determinate dalla duplicazione del gene, dove è evidenziabile una normale mielinizzazione dei tratti corticospinali, delle radiazioni ottiche e del corpo calloso. Questo ha permesso di ipotizzare che la presenza di normale mielinizzazione dei tratti corticospinali sullo sfondo di una ipomielinizzazione diffusa possa essere considerato un marker della PMD da duplicazione del gene PLP. Alle immagini diffusion-weighted si riscontra un pattern simil-neonatale con un certo grado diffusione anisotropica in corrispondenza di specifiche aree, a suggerire un meccanismo di tipo non o dis-mielizzante. La spettroscopia in risonanza magnetica può evidenziare un ridotto picco di NAA, soprattutto nella sindrome PLP1 null, mentre, nelle forme determinate da duplicazione del gene PLP, è frequente il riscontro di un aumento del picco NAA con conseguenti problemi di diagnosi differenziale rispetto alla malattia di Canavan (Takanashi et al., 2002). Neurofisiologia: − test dei movimenti oculari: sono in grado di definire le caratteristiche del nistagmo presenti nella malattia e risulterebbero probabilmente utili per definirne eventuali caratteri patognomonici; − Potenziali evocati: i potenziali visivi, acustici e somatosensitivi mostrano latenze della componente periferica normali o comunque vicini alla norma, con latenze della componente centrale, invece, prolungate o assenti. − Gli studi sulla velocità di conduzione nervosa sono nella norma, eccetto nelle forme di PLP null che presentano neuropatia periferica.

97

Genetica molecolare: Per le duplicazioni/delezioni (50-75% delle mutazioni) si applica la FISH in interfase (falsi negativi per piccole duplicazioni e falsi positivi per duplicazioni di regioni adiacenti il gene PLP), il Southern blot e la PCR quantitativa; per le mutazioni puntiformi (15-25% delle mutazioni) le analisi di sequenza. Diagnosi differenziale: I bambini affetti da malattia di Pelizaeus-Merzbacher ricevono spesso in fase iniziale diagnosi di paralisi cerebrale o encefalopatia non evolutiva. La diagnosi differenziale avviene con: − Altre leucodistrofie: adrenoleucodistrofia X-linked, malattia di Krabbe, malattia di Canavan (assenza di nistagmo, velocità di conduzione nella norma e pattern MRI tipico), sindrome CACH/VWM, malattia di Alexander. − Distrofia muscolare congenita da deficit di merosina − Malattia di Salla La SPG2 deve essere distinta in particolare dalla SPG1, ma anche dalle altre forme di paraparesi ereditaria. Terapia: La terapia ha essenzialmente carattere sintomatico. Difficoltà di deglutizione e complicanze respiratorie sono di frequente riscontro ed i pazienti devono essere tenuti sotto controllo; in caso di grave disfagia è indicata la gastrostomia a permanenza. Gli episodi convulsivi, che compaiono nelle forme connatali più gravi, in assenza di quadri epilettici franchi all’EEG, necessitano di terapia anticonvulsivante ed i pazienti sembrano rispondere in particolare al trattamento con carbamazepina. La terapia fisica, i farmaci antispastici (lioresal, diazepam etc.), i dispositivi ortopedici e, in casi estremi come nelle gravi contratture, la terapia chirurgica, sono indicati al controllo della spasticità. La scoliosi, grave nelle forme avanzate di malattia, richiede l’utilizzo

98

della sedia a rotelle per migliorare la meccanica respiratoria ed in caso di grave compromissione della ventilazione sono indicati interventi chirurgici di correzione ortopedica. Infine i deficit cognitivi migliorano grazie al sostegno scolastico ed all’utilizzo di dispositivi elettronici ed altri strumenti che possano essere d’aiuto nella comunicazione e nella stimolazione dei soggetti affetti. •

LEUCODISTROFIA

AUTOSOMICA

DOMINANTE

AD

ESORDIO

NELL’ADULTO (ADLD, PELIZAEUS-MERZBACHER DISEASE AUTOSOMAL DOMINANT

OR

LATE-ONSET

TYPE,

MULTIPLE

SCLEROSIS-LIKE

DISORDER ) Si tratta di una leucodistrofia a trasmissione autosomica dominante determinata da una mutazione di un gene, non ancora identificato, presente sul cromosoma 5. Descritta, probabilmente, già nel 1941 (Lowenberg et al., 1941), ne vennero evidenziate nel 1964 (Zerbin-Rudin and Peiffer, 1964) inizialmente le analogie cliniche con la PMD, pur in presenza di un meccanismo di trasmissione genetica differente, e nel 1984 (Eldridge et al., 1984) le somiglianze cliniche con la Sclerosi multipla. Gli studi neuropatologici (Schwankhaus et al. 1994, Coffeen et al. 2000) e di neuroimaging (Labauge et al., 2004) hanno permesso di definire gli aspetti clinico patologici di questa malattia che pur rientrando nella categoria delle leucodistrofie ortocromatiche sembra essere determinata da alterazioni geniche differenti dalle altre forme morbose incluse in questa categoria diagnostica. Principali aspetti di genetica-molecolare: Nel 2000 Coffeen et al. hanno effettuato uno studio genomewide in 19 soggetti di una medesima famiglia (12 affetti da ADLD e 7 soggetti sani) definendo una regione di 4cM sul cromosoma 5q31 ad alto tasso di linkage con la malattia. Nel 2006 Padiath et al. hanno evidenziato una duplicazione del gene LMNB1 in quattro famiglie affette da ADLD con una sovraespressione della lamina B1 nei tessuti cerebrali dei soggetti

99

affetti. Anticorpi anti-lamina B1 sono presenti in numerosi soggetti affetti da malattie autoimmuni ed inoltre la lamina B1 costituisce uno degli antigeni riconosciuti dagli anticorpi monoclonali diretti contro le placche dei soggetti affetti da sclerosi multipla. Sono stati avviati studi per identificare analogie e caratteristiche d’espressione della lamina B1 nei soggetti ADLD e in quelli affetti da sclerosi multipla. Manifestazioni cliniche: La malattia esordisce intorno alla terza/quarta decade anche se sintomi da disfunzione autonomica (disfunzioni vescicali ed ano-rettali, impotenza, ipotensione ortostatica, insufficienza della midollare surrenale con ipoglicemia) possono comparire in precedenza. La malattia si presenta con alterazioni piramidali e cerebellari (disturbo atasso/spastico o paralisi spastica, nistagmo), con un interessamento contemporaneo anche dei cordoni posteriori. La malattia presenta dei peggioramenti sintomatologici in coincidenza con infezioni virali. I principali sintomi sono: Sintomi cardiovascolari

Ipotensione ortostatica

oculari

Nistagmo

gastrointestinale

Disfunzioni di transito

Dell’apparato genito-urinario

Impotenza e disfunzioni vescicali

cutanei

iperidrosi

neurologici

Segni cerebellari Atassia cerebellare Deficit della motilità fine Segni piramidali Spasticità Iper-reflessia Riflesso cutaneo plantare positivo Sindrome pseudobulbare

100

Diagnosi: Alla TC ed alla MRI sono presenti alterazioni della sostanza bianca che iniziano in corrispondenza dei lobi frontali e si estendono progressivamente fino ad interessare i centri semiovali ed il cervelletto. La demielinizzazione ha carattere simmetrico con prevalente interessamento fronto-parietale e tendenza alla degenerazione cavitaria. Gli studi neuropatologici hanno evidenziato un alterazione vacuolizzante della mielina con preservazione dell’oligodendroglia, ma presenza di oligodendrociti a citoplasma “fumoso” e riduzione del numero degli astrociti in assenza di gliosi reattiva e di infiltrato infiammatorio. La somiglianza alla Sclerosi Multipla, in assenza di una reazione autoimmune, hanno portato allo studio dei geni regolatori della risposta immune (Il-3, IL-4, IL-5, CSF-2) senza evidenza di alcuna alterazione. La lesioni riscontrate ricalcano quelle da demielinizzazione tossica da esaclorofene e cuprizone. Quest’ultimo causa una up-regulation del’IGF-1 negli astrociti e ricalca alcuni aspetti dell’ADLD. La scoperta del gene mutato nell’ADLD e della sua proteina potrebbero fornire

ulteriori

chiarimenti

per

comprendere

i

meccanismi

alla

base

dell’assemblaggio e del mantenimento del rivestimento mielinico. •

MALATTIA DI ALEXANDER

La malattia di Alexander è determinata da una mutazione del gene che codifica per la proteina gliale acida fibrillare (GFAP) e rappresenta l’unico esempio noto di disordine genetico che interessa le cellule astrocitarie, il tipo cellulare maggiormente rappresentato nel SNC. Presenta quattro sottotipi clinici differenziati in relazione all’età di esordio: forma neonatale (rara), forma infantile (71% dei casi), forma giovanile (11% dei casi) e forma dell’adulto (rara). Descritta per la prima volta da Alexander W.S. nel 1949 presenta evidenti analogie con la malattia di Canavan ed un modello di ereditarietà di tipo autosomico dominante. Non sono disponibili studi di

101

prevalenza, ma la malattia viene considerata poco frequente con un totale di 300 casi descritti a partire dalla sua identificazione. Principali aspetti di genetica molecolare: La malattia è determinata dalla mutazione del gene della GFAP, localizzato sul cromosoma 17q21, costituito da nove esoni per una lunghezza di 9,8 kb. La proteina da esso codificata, 432 aminoacidi, appartiene alle proteine dei filamenti intermedi e sembra rivestire un ruolo nel regolare la morfologia e la motilità degli astrociti nonché nella interazione fra astrociti ed oligodendrociti, le alterazioni di quest’ultima funzione sono probabilmente alla base delle lesioni demielinizzanti (Messing et al. 2001). Finora sono state descritte 24 differenti mutazioni puntiformi della GFAP, tutte in eterozigosi, che determinano un guadagno o comunque una alterazione della funzione della proteina come dimostrato dagli studi sui topi (i topi GFAP-null presentano un fenotipo normale, mentre quelli che sovraesprimono il gene presentano un quadro istopatologico analogo alla malattia di Alexander [Brenner et al. 2001 e Messing e Brenner 2003]). Le mutazioni più frequenti interessano l’esone 1 (54%), l’esone 4 (31%), l’esone 8 (7%), l’esone 6 (4%), l’esone 5 (3%), e sono costituite da mutazioni puntiformi che si associano ad un trascritto alternativo e mRNA differenti per sito d’inizio della trascrizione o per splicing alternativo dell’RNA. Le mutazioni determinerebbero un accumulo della proteina che presenterebbe proprietà chimicofisiche alterate. E’ stato ipotizzato che tale accumulo si possa determinare anche per alterazioni delle sequenze promoter ed enhancer. Tutte le alterazioni del gene finora identificate rappresentano mutazioni de novo e delle 24 mutazioni descritte 12 interessano un residuo di arginina con funzione evidentemente critica per l’attività proteica.

102

Manifestazioni cliniche: Dal punto di vista clinico sono due le forme più frequenti, distinte in relazione all’età d’esordio, quattro se si tengono in considerazione anche le forme più rare descritte in letteratura:    

Forma neonatale Forma infantile Forma giovanile Forma dell’adulto

Forma neonatale Esordisce intorno al primo mese di vita ed è caratterizzata da una rapida progressione sintomatologica ed importante disabilità fino al decesso, che si verifica intorno al secondo anno di vita. Il quadro epilettico, costantemente presente, compare precocemente, e spesso non è responsivo alla terapia farmacologia. Si riscontrano inoltre: idrocefalo (con aumento della pressione intracranica per stenosi acqueduttale),

importanti

anomalie

della

sostanza

bianca

a

localizzazione

prevalentemente frontale e periventricolare, interessamento dei gangli della base e del cervelletto, ritardo mentale e motorio senza spasticità ed atassia. E’ evidenziabile un aumento della proteinorrachia nel CSF. Forma infantile: E’ una delle due forme, in termini di frequenza, di maggior riscontro ed esordisce intorno al secondo anno di vita con una sopravvivenza che varia da poche settimane a qualche anno, in ogni caso l’exitus avviene entro l’adolescenza. Il fenotipo clinico è estremamente variabile ed è possibile riscontrare ritardo psicomotorio progressivo con alterazioni delle tappe dello sviluppo, megalencefalia con macrocrania e prominenza delle bozze frontali, epilessia (è stata anche descritta la presenza, in associazione al quadro epilettico, di spasmi infantili), iper-reflessia con segni piramidali, atassia, ed idrocefalo da stenosi acqueduttale.

103

Forma giovanile: Esordisce intorno ai dieci anni di vita, raramente nell’adolescenza, ed è spesso confusa con una patologia focale cerebrale del tipo “massa occupante spazio”. La sopravvivenza è variabile con decesso che può sopravvenire nella prima adolescenza fino ai 20-30 anni. Sono presenti segni bulbari o pseudobulbari con difficoltà di deglutizione, vomito e disartria/disfonia, spasticità agli arti inferiori, deficit di coordinazione fino ad un quadro atassico associato a peggioramento progressivo delle facoltà intellettive, epilessia, megalencefalia e macrocrania, difficoltà respiratorie. Foma dell’adulto: E’ la forma meno comune di presentazione di questa malattia, e presenta una estrema variabilità dello spettro fenotipico. Può ricalcare gli aspetti principali della forma giovanile con un esordio più tardivo ed una progressione più lenta. La sopravvivenza è variabile con decesso dopo pochi anni o anche dopo qualche decade di malattia. Molti casi vengono rilevati occasionalmente all’autopsia ed il decesso è spesso, in queste circostanze, imputabile ad altre malattie intercorrenti. Presenta sintomi d’interessamento bulbare e pseudobulbare (mioclono palatale, disfagia, disfonia, disartria con parola scandita), segni piramidali (iper-reflessia, spasticità e Babinski positivo),

segni

cerebellari

(atassia,

dismetria

e

nistagmo),

disautonomie

(incontinenza, costipazione, pollachiuria, ritenzione urinaria, impotenza, ipoglicemia, ipotermia, ipotensione ortostatica), disturbi del sonno (apnee notturne), alterazioni posturali, emi- o quadriparesi/plegia, epilessia, e diplopia. Altri sintomi associati alle diverse forme e descritti in letteratura comprendono: natalità post-termine, ipotonia, episodi sincopali, alterazioni dell’accrescimento, nevi anomali, ipotiroidismo, ipertensione, diabete mellito, scoliosi, cifosi, anomalie palatali, collo corto. Sono stati descritti alcuni soggetti asintomatici diagnosticati per

104

una mutazione della GFAP accidentalmente rilevata e giunti all’attenzione clinica per altre motivazioni (traumi oculari o bassa statura). Anatomia patologica: La sostanza bianca dei lobi frontali e, meno spesso, dei temporali, è interessata da estesa demielinizzazione che talora evolve in vere e proprie lesioni cavitarie. Nelle fasi successive il processo patologico può coinvolgere tutta la sostanza bianca degli emisferi cerebrali, del cervelletto e del tronco cerebrale con dilatazione delle cavità ventricolari. Dal punto di vista istologico, nelle aree interessate dal processo morboso, si dimostra diffusa vacuolizzazione per degenerazione delle guaine mieliniche ed è caratteristico il riscontro, in sede subpiale, subependimale e perivascolare, di fibre eosinofile con disposizione radiale rispetto alle superfici adiacenti, denominate fibre di Rosenthal. Tali fibre sono contenute esclusivamente nel soma e negli assoni astrocitari ed inizialmente furono ritenute patognomoniche della malattia di

Alexander.

Successivamente, tuttavia, sono state riscontrate in numerosi altri processi patologici (SM, gliomi, mielinolisi pontina centrale, spongioblastomi). Il loro rilievo rimane comunque un criterio diagnostico differenziale tra la malattia di Alexander e le altre leucodistrofie. Diagnosi: Neuroimaging: Lo studio di 217 soggetti effettuato da Van der Knaap ha evidenziato cinque elementi, all’MRI, peculiari per la diagnosi di malattia di Alexander:     

Anomalie diffuse della sostanza bianca a prevalente distribuzione frontale Aree di alterato segnale: ipointense in T1 ed iperintense in T2 Anomalie dei gangli della base e del talamo; in particolare elevato o diminuito segnale in T2 o cavitazioni multiple od atrofia Anomalie del tronco encefalico o del midollo Aumento del contrasto della linea di demarcazione ventricolare, dell’anello periventricolare, della sostanza bianca frontale, del chiasma ottico, del fornice, dei gangli della base, del talamo, del nucleo dentato e del tronco encefalico.

105

Alla H-MRS si evidenzia una elevazione del picco mI, la comparsa del picco del lattato ed un basso NAA. Questi dati facilitano una diagnosi differenziale sia rispetto alla malattia di Caravan, che presenta una elevazione del picco NAA, che nei confronti della MLC nella quale non è descritta la presenza del picco del lattato. EEG: Anomalie aspecifiche del tipo onde lente nell’area frontale. Neuroistopatologia: Prima dell’introduzione della genetica molecolare, la malattia di Alexander veniva diagnosticata sulla base della dimostrazione, in ambito bioptico od autoptico, della presenza delle fibre di Rosenthal. Si tratta di corpi inclusi citoplasmatici composti dall’aggregazione di complessi formati dalla GFAP, dalla vimentina, dalla α e β cristallina, dall’HSP27 evidenziabili unicamente negli astrociti. Le fibre di Rosenthal aumentano di numero e volume nel corso della malattia. Le fibre di Rosenthal non sono specifiche della malattia di Alexander e sono state descritte persino in soggetti affetti da malattie sistemiche come tumori (linfomi, cancro ovario) ed insufficienza respiratoria e cardiaca nonché diabete mellito. Sono riscontrabili anche in patologie del SNC come nell’astrocitoma pilocistico, in lesioni gliali di vecchia data anche se la preponderanza delle fibre di Rosenthal nella malattia di Alexander presenta aspetti caratteristici. Test genetico-molecolari: Sono disponibili in ambito clinico i test per le mutazioni più frequenti (esoni 1,4,8) ed il sequenziamento dell’intero gene nel caso di mutazioni ricorrenti. Lo studio genetico è praticabile anche nel campo della diagnosi prenatale. Diagnosi differenziale: La malattia di Alexander pone problemi di diagnosi differenziale con tutte le patologie che presentano, in età infantile, megalencefalia, ritardo dello sviluppo e

106

spasticità e, nei bambini più grandi, con quelli che presentano spasticità, segni di interessamento del tronco encefalico con o senza megalencefalia e convulsioni. A causa dell’aspecificità dei sintomi, la malattia di Alexander può essere confusa con le acidurie organiche (in particolare la L2-idrossiglutaricoaciduria), con i disordini della biogenesi perossisomiale (Zellweger-spectrum) e con altre leucodistrofie come la X-linked adrenoleucodistrofia, la leucodistrofia metacromatica, la malattia di Krabbe, la malattia di Canavan e la leucoencefalopatia megalencefalica con cisti subcorticali, anche se la distribuzione dell’interessamento della sostanza bianca cerebrale è, nella malattia di Alexander, patognomonico (alterazioni della sostanza bianca a prevalente distribuzione frontale con progressione rostro-caudale). Terapia: Non esiste alcuna terapia per la malattia di Alexander ed il trattamento si limita ad interventi finalizzati al trattamento dei sintomi generali, alle problematiche nutrizionali, alla terapia antibiotica delle infezioni intercorrenti ed all’uso di farmaci anti-epilettici per il controllo dei sintomi convulsivi. •

LEUCODISTROFIA CON VANISHING WHITE MATTER (LVWM/CACH)

La sindrome CACH/LVWM (Childhood ataxia with Central nervous system Hypomielination/Vanishing White Matter Leukodystrophy) è un patologia autosomica recessiva cronica, progressiva con fenomeni a carattere episodico. Rappresenta il primo esempio di malattia determinata dalla mutazione di un fattore di inizio della traduzione proteica, l’eukariotic translation initiation factor 2B (eIF2B), che appartiene alla famiglia dei GEFs (Guanine nucleotide Exchanging Factors). Il termine vanishing white matter venne introdotto in relazione agli studi di risonanza magnetica dei pazienti affetti, nei quali l’intensità di segnale della sostanza bianca assumeva valori prossimi a quelli del liquido cefalorachidiano o della componente

107

acquosa tissutale, come da scomparsa della rivestimento mielinico. Definita nei suoi aspetti principali nel corso degli ultimi anni ( Hanfeld et al nel 1993, Schiffmann et al. nel 1994, Tedeschi et al. nel 1995 e van der Knaap et al. nel 1997), presenta un fenotipo clinico variabile comprendendo una forma congenita/prenatale, una forma subacuta ad esordio infantile, una forma giovanile ed una forma ad esordio nell’età adulta. La malattia include al suo interno anche alcune forme di Creeleucoencephalopathy (le sottoforme definite originariamente come Cree-encephalitis), l’ovarioleucodistrofia (descritta originariamente negli anni ’90 come una entità clinica distinta) ed alcune forme cliniche che ricalcano gli aspetti clinico radiologici della VWML, ma che presentano un modello ereditario di tipo autosomico dominante. Con il passare del tempo questa malattia si sta rivelando una delle cause più importanti di leucodistrofia, essendo responsabile di buona parte delle forme morbose precedentemente non diagnosticabili. La sua prevalenza esatta non è nota, ma viene considerata fra le forme più comuni di leucodistrofia ed in molti paesi la sua frequenza sembra essere vicina o pari quella della leucodistrofia metacromatica. Principali aspetti di genetica molecolare: La fase iniziale della sintesi proteica nelle cellule eucariotiche è il risultato di una complessa ed altamente regolata interazione fra subunità ribosomiali, mRNA, metionil-tRNA aminoacilato e fattori di inizio della traduzione che vanno sotto il nome di eukaryotic translation initiation factors (eIFs). L’insieme di questi fattori controlla il corretto posizionamento del Met-tRNAiMet sul sito P dell’unità 40S ribosomiale in corrispondenza del codone AUG di inizio di ogni mRNA. Per iniziare la traduzione l’eIF2 forma un complesso ternario (TC) eIF2⋅GTP⋅MettRNAiMet che lega il Met-tRNAiMet alla subunità 40S ribosomiale, successivamente, la

108

GTPase activating protein eIF5 stimola l’idrolisi del GTP rilasciando il complesso binario eIF2-GDP dando inizio così alla sintesi proteica. Il complesso binario formato dalla eIF2-GDP, una volta liberato, per ritornare allo stato attivo e poter formare nuovamente il complesso ternario deve scindersi dal legame col GDP. Questa fase avviene per azione dell’eIF2B, che agisce come guanidine exchanging factor (GEF) e promuove il rilascio del GDP dall’eIF2 ed il legame col GTP. L’attività della eIF2B è regolata da numerosi meccanismi di controllo sia per via indiretta, tramite la fosforilazione dell’eIF2, sia per via diretta, tramite la fosforilazione dell’eIF2B stessa, ma è anche regolata dai segnali insulinici, permettendo così l’attivazione della sintesi proteica in risposta a segnali di crescita. Per quanto riguarda l’aspetto strutturale l’eIF2 è costituito da tre subunità differenti: la eIF2α (che contiene un residuo di serina che viene fosforilato ed ha così funzioni di regolazione dell’attività dell’eIF2), la eIF2β (che lega l’eIF2B e l’eIF5) e l’eIF2γ (che contiene il sito di legame GTP/GDP e quello per il Met-tRNAiMet). L’eIF2B è formato invece da cinque subunità (Figura 16): le eIF2Bα, β e δ che formerebbero un sottocomplesso con funzioni di inibizione dell’attività dell’eIF2B in risposta alla fosforilazione dell’eIF2α (l’ eIF2Bβ fisserebbe anche il GTP/GDP) e l’eIF2Bγ ed ε che contengono i segmenti catalitici della funzione di nucleotide exchange (la subunità ε avrebbe, per questo, un .ruolo predominante ed avrebbe anche funzione di legame con altri initiation factors).

Figura 16: Complesso tridimensionale formato dall’aggregazione delle cinque subunità che entrano nella costituzione dell’eIF2B (tratto da Wei Li et al., 2004).

109

La sindrome CACH/VWM è determinata proprio dalle mutazioni, autosomiche recessive, di una delle cinque diverse subunità dell’eIF2B, la cui organizzazione genica presenta le caratteristiche elencate sotto:

Subunità EIF2B1 o subunità α EIF2B2 o subunità β EIF2B3 o subunità γ EIF2B4 o subunità δ EIF2B5 o subunità ε

Locus cromosomico Chr. 12 14q24 Chr. 1 2p23.3 3q27

Numero di esoni 9 8 14 13 16

Lunghezza del cDNA in bp 1659-918 1523-1056 1602-1359 1643-1572 2638-2166

Sono note oltre 70 diverse mutazioni delle subunità dell’eIF2B, comprendenti mutazioni puntiformi missense e nonsense, alcune delezioni e delezioni-inserzioni. Non è stato però ancora possibile spiegare come le mutazioni dell’eIF2B, una proteina ubiquitaria, determinino alterazioni che interessano prevalentemente la sostanza bianca. Il ruolo dell’eIF2B nella regolazione della sintesi proteica in corso di stress è in grado però di spiegare i fenomeni di deterioramento neurologico episodico che seguono traumi cranici ed episodi febbrili. Le mutazioni riscontrate determinano una riduzione dell’attività GEF per aberrazioni della conformazione proteica, con compromissione della capacità di formazione di complessi eIF2B funzionalmente e cataliticamente normali. E’ probabile che la perdita di funzione GEF stimoli la traduzione di mRNA che codificano per composti proteici simili a quelli che vengono rilasciati in condizione di stress. Di tutte le mutazioni responsabili della malattia le mutazioni null, come ad esempio le nonsense, che aboliscono l’attività dell’eIF2B, sono probabilmente letali così da essere presenti solo in eterozigosi con mutazioni missense. Manifestazioni cliniche: La malattia si manifesta dal punto di vista neurologico con l’associazione di atassia, spasticità, ed atrofia ottica di vario grado. Il decorso clinico, rapido nelle forme ad 110

esordio precoce, è caratterizzato da un deterioramento mentale ingravescente, meno severo nelle forme ad esordio tardivo. Il decorso, che ha carattere cronico progressivo, è segnato ed esacerbato da un deterioramento rapido in coincidenza con episodi febbrili o a seguito di traumi cranici. Nella forma giovanile ed adulta sono inoltre presenti, nelle pazienti femmine, disfunzioni ovariche determinando un quadro sindromico che in precedenza veniva designato con la denominazione di ovarioleucodistrofia .La malattia comprende: –

Forma prenatale: Si presenta intorno al terzo trimestre di gravidanza con oligoidramnios, ritardo di crescita, microcefalia, epatosplenomegalia e ridotti movimenti fetali. Subito dopo la nascita compaiono difficoltà di nutrizione, vomito, ipotonia, contratture e cataratta e la microcefalia può o meno essere presente. Compaiono quindi apatia, quadri convulsivi difficilmente controllabili farmacologicamente, crisi apnoiche fino al coma. L’interessamento di altri distretti organici determina epatosplenomegalia, ipoplasia renale, pancreatite e disgenesia ovarica. Il decorso clinico è estremamente rapido e i pazienti muoiono generalmente entro il primo anno di vita.



Forma neonatale: Esordisce intorno al primo anno di vita ed il decorso è estremamente severo con morte entro pochi mesi. Possono essere presenti un quadro soporoso, irritabilità e rapida perdita delle capacità motorie specialmente in coincidenza con infezioni intercorrenti. Fanno parte di questa forma anche alcuni casi di “Cree leukoencephalopathy” descritti da Black et al. (1988) e che si manifestano in alcune popolazioni aborigene del Nord America con ipotonia, comparsa precoce di convulsioni, spasticità, iperventilazione, vomito spesso

111

associato a febbre e diarrea, sintomi regressivo-involutivi, cecità, letargia ed arresto dello sviluppo cranico con morte entro i due anni di età. –

Forma infantile precoce: In fase iniziale i pazienti presentano uno sviluppo normale con occasionale lieve ritardo motorio e del linguaggio. Il sintomo iniziale più frequente è un quadro atassico che compare fra 1-5 anni con dismetria e tremore che sono seguiti, spontaneamente o a seguito di traumi cranici, da uno stato comatoso. La malattia evolve evidenziando un deterioramento progressivo che determina difficoltà di deambulazione, tremore, spasticità con iper-reflessia, disartria e quadri epilettici. Una volta persa la capacità di deambulazione il decorso clinico tende a stabilizzarsi per parecchi anni, la circonferenza cranica è in genere nella norma e deficit di deglutizione ed atrofia ottica compaiono solo tardivamente. Il SNP non è interessato dalla malattia, le facoltà mentali sono generalmente risparmiate e la progressione varia da individuo ad individuo ed anche all’interno di membri di una stessa famiglia con morte che può sopravvenire da 1 a 5 anni dall’esordio ma anche notevolmente più tardi.



Forma tardo-infantile o giovanile: I pazienti manifestano i primi sintomi della malattia tra i 5 e i 15 anni con diplegia spastica progressiva a lenta evoluzione, con preservazione delle funzioni cognitive, con alternanza di periodi di stabilizzazione del decordo o addirittura miglioramento delle funzioni motorie e con una sopravvivenza a lungo termine. Sono stati descritti però casi con decorso tumultuoso e decesso a distanza di pochi mesi dall’esordio.



Forma adulta: Disturbi della sfera umorale con compromissione cognitiva sono stati descritti nelle forme ad esordio nell’adolescenza. Sono presenti sintomi neurologici del tipo neurite ottica ed emiparesi o grave cefalea. Sono stati descritti anche casi di adulti, sintomatici e non, in una famiglia con presenza di due

112

mutazioni nello stesso gene e figli tipicamente affetti (Leegwater et al. 2001, Biancheri et al. 2003, Ohtake et al. 2004, van der Knaap et al. 2004). Nonostante la variabilità intrafamiliare esiste una correlazione genotipo-fenotipo fra tipo di mutazione ed età d’esordio e severità dell’impegno clinico: 

Soggetti omozigoti per la mutazione T91A nell’eIF2B5 presentano un fenotipo che può variare fra la forma infantile e la forma dell’età adulta asintomatica



Alcune mutazioni dell’eIF2B5, come la R113H, non si manifestano mai sotto la forma ad esordio nell’infanzia.



Alcune mutazioni dell’eIF2B5, come la V309L, sono generalmente associate ad un decorso particolarmente severo.

Anatomia patologica: Gli studi neuropatologici hanno evidenziato un quadro di leucodistrofia ortocromatica con lesioni cavitarie, in assenza di atrofia, e risparmio delle fibre assonali. L’interessamento mielinico è predominante in corrispondenza della sostanza bianca emisferica. L’analisi macroscopica dimostra una sostanza bianca meno evidenziabile con grosse zone translucide; mentre l’analisi microscopica permette di rilevare vacuolizzazioni diffuse ed astrogliosi in presenza di oligodendrociti caratteristici con citoplasma “fumoso” ed altre cellule descritte come macrofagi carichi di lipidi. Alla microscopia elettronica sono presenti ipomielinizzazione, demielinizzazione e gliosi con proteine mieliniche diminuite e riduzione del contenuto in lipidi caratteristici della mielina. La severità delle lesioni della sostanza bianca contrastano con la contenuta reazione astrogliale e microgliale ed, in corrispondenza della sostanza bianca colpita dal processo patologico, è presente un aumento del numero degli oligodendrociti. Il contenuto proteico e lipidico della mielina è ridotto ed in 1 caso è stata descritta una riduzione, misurata tramite Western e Southern Blot, del contenuto di proteina proteolipidica.

113

Diagnosi: Viene posta sulla base del quadro clinico, delle alterazioni alla MRI e dell’identificazione della mutazione genica responsabile: Quadro clinico: Nel 1998 van der Knaap ha proposto i seguenti elementi diagnostici per la vanishing white matter: a) In fase iniziale lo sviluppo mentale e motorio è normale o solo lievemente ritardato b) Il deterioramento neurologico ha decorso cronico progressivo ed episodico. Infezioni intercorrenti o traumi cranici sono in genere responsabili degli episodi di deterioramento improvviso che può giungere fino alla letargia od al coma. c) L’interessamento neurologico consiste in atassia cerebellare, e spasticità. L’atrofia ottica può essere o meno presente, così come l’epilessia che non rappresenta comunque un sintomo predominante della malattia. Le funzioni mentali possono essere compromesse, anche se mai allo stesso livello di quelle motorie. Neuroimaging: Lo studio MRI mostra interessamento simmetrico e diffuso della sostanza bianca emisferica. L’intensità di segnale è prossima a quella del CSF nelle sequenze T1, T2 e FLAIR; inoltre in T1 e nella FLAIR si evidenziano strie di tessuto residuo in corrispondenza delle zone di iperintensità di segnale, di aspetto radiato in sezione sagittale e coronale, e puntiformi in corrispondenza del centro semiovale alle sezioni trasverse. E’ presente atrofia cerebellare più o meno severa a prevalente componente vermiana. Con il passare del tempo la sostanza bianca “scompare” (vanish) ed è sostituita da liquor e da formazioni cistiche cavitarie. Alle

immagini

diffusion-weighted

le

aree

cavitarie

periventricolari

sono

marcatamente ipointense in accordo con un processo di demielinizzazione che volge verso la totale scomparsa del rivestimento mielinico con aumento della diffusione isotropica.

114

Alla H-MRS si evidenzia riduzione dei picchi NAA, Cho e Cr e comparsa del picco del lattato, come da presenza del solo CSF e di poco tessuto cerebrale (aree cistiche). Test genetico molecolari: Analisi di sequenza e ricerca delle mutazioni dell’eIF2B1 (1% dei casi), dell’eIF2B2 (16% dei casi), dell’eIF2B3 (4% dei casi), dell’eIF2B4 (12% dei casi) e dell’eIF2B5 (67% di casi). Test di laboratorio: L’analisi del CSF ha evidenziato nel passato un moderato aumento del contenuto di glicina (van der Knaap et al. 1999). Negli ultimi anni lo studio sui proteomi nel CSF si è intensificato puntando alla ricerca di un biomarker che potesse sostituire la diagnosi genetica, eccessivamente laboriosa e lunga a causa dei 57 esoni che costituiscono il gene responsabile della malattia. Recentemente (Vanderver et al. 2005) è stata identificata una riduzione dei livelli di asialotransferrina nel liquor, rilevati tramite spettroscopia di massa e corsa su gel, che correlano costantemente con la presenza della malattia. Il significato di questa alterazione appare ancora incerto nonostante siano numerosi gli studi che dimostrano una associazione fra la transferrina ed il processo di maturazione oligodendrocitaria e di mielinizzazione (Connor et al. 1987, Espinosa de los Monteros A. et al.1988, Espinosa de los Monteros A. et al.1999, Gerber M.R. et al. 1989, Connor et al 1993, Escobar-Cabrera et al. 1997, Espinosa-Jeffrey A. et al. 2002, Ortiz E.H. 2005). L’origine stessa di questo metabolita appare incerta (passaggio dal siero attraverso la barriera ematoencefalica o biosintesi in loco), ma l’identificazione di questo marker oltre a fornire una via più rapida verso la diagnosi permette di ipotizzare una nuova linea di studio per la comprensione della patogenesi di questa malattia.

115

Diagnosi differenziale: Altre malattie caratterizzate da un interessamento diffuso della sostanza bianca durante l’infanzia come: l’adrenoleucodistrofia X-linked, la malattia di Krabbe, la malattia di Canavan, la malattia di Alexander, la leucoencefalopatia megalencefalica con cisti subcorticali, malattie mitocondriali come il deficit di piruvto deidrogenasi o di piruvato carbossilasi, i PLP1-related disorders, la CADASIL ed altre malattie acquisite della sostanza bianca come la SM. Terapia: La terapia è unicamente a carattere sintomatico e consiste nella riabilitazione motoria principalmente finalizzata al controllo della spasticità e dell’atassia, con l’ausilio di dispositivi ortopedici per l’anca ed il piede in caso di ipotonia o debolezza dei dorsiflessori dell’anca. I quadri convulsivi richiedono terapia farmacologica antiepilettica. Visti gli effetti sul decorso clinico delle infezioni, della febbre e dei traumi cranici, sono indicate la vaccinazione anti-influenzale, l’assunzione di antibiotici a basse dosi durante il periodo invernale ed in caso di infezioni minori, e l’assunzione di farmaci antipiretici nel caso di febbre. •

LEUCODISTROFIA

CON

MEGAENCEFALIA

E

FORMAZIONI

CISTICHE SUBCORTICALI (MLC1) La leucodistrofia megalencefalica con cisti subcorticali (MLC1 o malattia di van der Knaap) è una malattia neurodegenerativa autosomica recessiva caratterizzata da leucoencefalopatia spongiforme con mielinopatia vacuolizzante. Descritta per la prima volta da Harbord et al. nel 1990, è stata definita nei suoi aspetti clinici e radiografici da van der Knaap et al. (van der Knaap M.S. et al., 1995) e Goutieres et al (1996) e si presenta, dal punto di vista clinico, con l’associazione di macrocrania ad

116

esordio

precoce,

interessamento

atassia

cognitivo

cerebellare, tardivo.

deterioramento Nonostante

i

motorio,

epilessia

parallelismi

con

ed altre

leucoencefalopatie spongiformi (malattia di Canavan, malattia di Alexander, LVWM, L-2-idrossiglutaricoaciduria ed alcune forme di distrofia muscolare da deficit di merosina [sebbene le cisti subcorticali in quest’ultimo caso siano per lo più assenti]) la MLC1 presenta caratteristiche peculiari sia per quanto concerne la distrettualità dell’interessamento della sostanza bianca sia per le caratteristiche del decorso clinico che presenta un andamento progressivo, ma a lenta evoluzione. La malattia è relativamente rara con un basso tasso di portatori eterozigoti nella popolazione, ma presenta un’incidenza inaspettatamente elevata in popolazioni con alti tassi di consanguineità come in Turchia (ed in particolare nell’Anatolia), nelle regioni dell’India Orientale (comunità Agarwal), e nelle comunità ebree della Libia, all’interno delle quali i soggetti condividono la stessa mutazione per effetto fondatore. Principali aspetti di genetica molecolare: La malattia è determinata da una mutazione autosomica recessiva del gene MLC1 (chiamato anche KIAA0027 o WKL1) localizzato sul cromosoma 22qter, costituito da 13 esoni per una lungezza di 26.214 basi (Figura 17). Il gene codifica per una proteina di membrana dotata di otto domini transmembranari (Figura 18), del peso di 41kD formata da 377 aminoacidi la cui funzione non è al momento nota. L’omologia con il canale del potassio Kv1.1, coinvolto in alcune forme di atassia episodica /miochimia, fa pensare che si possa trattare di una proteina con funzione di canale ionico (l’associazione con quadri epilettici sembrerebbe poterlo confermare), mentre la struttura analoga ai trasportatori ABC2 type od ai trasportatori sodio/galattoside fa pensare ad una proteina con funzione di carrier proteico di un substrato sconosciuto.

117

Figura 17: Struttura genomica dell’MLC1. Le porzioni rettangolari indicano gli esoni, gli introni sono rappresentati dalle linee in nero. Le parti in grigio/nero identificano i domini transmembranari (tratto da Leegwater P.A.J. et a., 2001)

Figura 18: Organizzazione strutturale macroscopica della proteina MLC1 caratterizzata dalla presenza di otto domini transmembrana. Nell’esempio è stato introdotto un epitopo HA per evidenziare il dominio extracellulare della MLC1 tramite anticorpi e per studiare l’eventuale oligomerizzazione della proteina (tratto da Teijido O. et al., 2004).

La proteina MLC1 forma degli omodimeri od oligomeri probabilmente tramite interazioni leucina-leucina (di cui sono ricchi i domini transmembrana 4 ed 8) e si posiziona in corrispondenza della membrana plasmatica. Studi anticorpali hanno permesso di evidenziare come la proteina sia prevalentementa espressa sulla membrana astrocitaria e sulle cellule ependimali, mentre sia assente nelle cellule oligodendrocitarie e microgliali. L’MLC1 è presente negli astrociti di tutto il distretto cerebrale ed è concentrata prevalentemente in corrispondenza dei processi cellulari, intervenendo probabilmente nella interazione cellula-cellula o nel loro accoppiamento ionico. L’assenza della proteina negli oligodendrociti e la sua presenza nella membrana degli astrociti fa pensare, in analogia alla malattia di Alexander, che il processo di alterazione della mielina sia il risultato indiretto di una disfunzione astrocitaria. L’MLC1 è anche presente in alta concentrazione in corrispondenza di alcune delle porzioni della barriera ematoencefalica (pia madre ed ependima) ed intorno ai vasi sanguigni, avendo probabilmente funzione di trasportatore ionico o di sostanze. La proteina è infine espressa in alcuni neuroni ed in particolare in

118

corrispondenza delle fibre e dei tratti assonali corticali e dell’ippocampo, suggerendo la possibilità che disfunzioni assonali siano alla base della dismielinizzazione. Sono note oltre 26 mutazioni differenti del gene che comprendono mutazioni missense, inserzioni, delezioni ed alterazioni dei siti di splicing, e quasi tutte sembrano determinare una alterazione della stabilità della proteina con mancata espressione della stessa sulla membrana. Sono presenti in letteratura casi di malattia in assenza di mutazione identificabile dell’MLC1, il che fa pensare alla presenza di una eterogeneità genetica ed alla presenza di altri geni responsabili della malattia. Manifestazioni cliniche: La malattia è caratterizzata da una macrocefalia di grado variabile, talora molto evidente (la macrocefalia è presente in tutti i soggetti affetti con diagnosi genetica confermata), presente alla nascita o, più frequentemente, a comparsa entro il primo anno di vita. In seguito, la velocità di aumento della circonferenza cranica si normalizza ed il valore si stabilizza intorno al 98o percentile. Lo sviluppo motorio e mentale sono inizialmente nella norma, o solo lievemente ritardati, ed il primo segno di malattia, se si eccettua la macrocrania, è in genere un ritardo nella deambulazione od un incertezza della marcia con frequenti cadute. Successivamente si assiste ad un lento, ma progressivo, deterioramento motorio con comparsa di atassia del tronco e delle estremità. Segni piramidali emergono solo tardivamente con riflessi osteotendinei vivaci e segno di Babinski positivo, e sono comunque dominati dal quadro atassico; il tono muscolare tende ad essere ipotonico, se si eccettua l’ipertonia dell’anca. Progressivamente la capacità di deambulazione viene persa ed i pazienti necessitano della sedia a rotelle già intorno alla prima o seconda decade di vita. Quasi tutti i pazienti presentano una epilessia già in fase precoce, normalmente di semplice trattamento farmacologico. Il deterioramento delle facoltà cognitive compare

119

tardivamente, e generalmente, è di grado poco severo; possono comparire difficoltà scolastiche negli ultimi anni della scuola primaria, anche se in alcuni soggetti le capacità intellettive sono interessate già nei primissimi anni. Il linguaggio diviene progressivamente disartrico e può essere presente disfagia. Alcuni soggetti presentano disturbi extrapiramidali come distonia ed atetosi. In coincidenza di traumi si può evidenziare un deterioramento episodico con le caratteristiche di uno stato epilettico, di incoscienza prolungata o di deterioramento motorio acuto, con recupero graduale. Alcuni pazienti presentano un decorso severo senza mai riuscire, o mantenendo per pochi anni, la capacità a deambulare. Sono stati descritti, comunque, anche casi benigni con sola macrocefalia e capacità di deambulazione autonoma fino alla quarta decade. La sopravvivenza è variabile con decesso dall’adolescenza ad oltre 40 anni. Non è stata descritta alcuna correlazione genotipo-fenotipo: la severità dell’impegno clinico non correla con il tipo di mutazione, ed il fenotipo clinico è estremamente variabile anche all’interno della stessa famiglia. E’ stato suggerito che la mutazione del MLC1 potesse essere causa di alcune forme di schizofrenia catatonica (ed in particolare la mutazione missense L309M), anche se studi recenti (Rubie et al., 2003) smentiscono tale ipotesi. Anatomia patologica: Gli studi istopatologici evidenziano una mielinopatia vacuolizzante cistica a prevalente localizzazione frontoparietale ed anterotemporale, con risparmio dell’area periventricolare, di quella occipitale, dei gangli della base, del corpo calloso e della porzione anteriore della capsula interna. La microscopia elettronica evidenzia la presenza di una miriade di vacuoli, ricoperti da uno fino a cinque strati di membrana, che rappresentano le singole lamelle mieliniche. I vacuoli sono concentrati nello strato più esterno delle lamelle mieliniche lasciando intatte le spirali interne.

120

Le cisti sono bilaterali e tendono ad ingrandirsi con il passare del tempo Diagnosi: La diagnosi di leucoencefalopatia megalencefalica con cisti subcorticali può essere posta in relazione a criteri di ordine clinico ed agli aspetti della MRI: Clinica: 

Macrocefalia alla nascita od entro il primo anno di vita



Sviluppo nella norma in fase iniziale oppure lieve ritardo motorio



Deterioramento motorio a decorso lento con atassia e lieve spasticità fino alla perdita della deambulazione autonoma



Disartria e disfagia



Movimenti extrapiramidali con distonia ed atetosi in fase avanzata



Interessamento cognitivo tardivo e comunque meno severo dell’impegno motorio



Epilessia controllata farmacologicamente



Deterioramento in coincidenza di traumi cranici (epilessia, incoscienza prolungata, peggioramento del quadromotorio)

Neuroimaging: 

Leucoencefalopatia diffusa vacuolizzante con sostanza bianca iperintensa in T2, ipointensa in T1, e di aspetto “rigonfio”



Corpo calloso, capsula interna ed tronco encefalico generalmente risparmiati, anche se non completamente normali



Sostanza bianca cerebellare con anomalie di segnale in assenza di cavitazione



Lesioni cistiche nelle regioni anterotemporali e frontoparietali



Col passare del tempo comparsa di atrofia ed incremento di volume e di numero delle cisti subcorticali, fino ad occupare, in alcuni soggetti, l’intera regione frontoparietale

Alle immagini diffusion-weighted si evidenzia una ipointensità di segnale in corrispondenza delle lesioni cistiche subcorticali ed una riduzione di segnale in corrispondenza della sostanza bianca affetta. L’ADC appare aumentato e nelle immagini diffusion-tensor compare una riduzione dell’FA.

121

I dati appaiono in contrasto con il meccanismo neuropatologico della malattia, il cui carattere vacuolizzante dovrebbe determinare una riduzione della diffusività. Alla H-MRS si evidenzia una riduzione dei picchi di NAA, di Cho e di Cr, con intensità di segnale simile per tutti e tre i metaboliti, mentre i picchi di mI e e/o di glicina sono conservati. Un TE di 30ms facilita la quantizzazione del picco di mI. Test genetico molecolari: L’analisi di sequenza è disponibile a livello clinico per la ricerca delle mutazioni note (~60-70% dei casi) Diagnosi differenziale: La diagnosi differenziale si pone con tutte le malattie caratterizzate dall’associazione di macrocefalia e leucoencefalopatia diffusa, ovvero: la malattia di Canavan, la malattia di Alexander, la GM2 gangliosidosi ad esordio infantile ed alcune forme di GM1 gangliosidosi, la L2-idrossiglutaricoaciduria e la distrofia muscolare congenita da deficit di merosina. Terapia: Finora i tentativi di trattare i pazienti con MLC hanno dato esito negativo. Sono stati utilizzati diuretici, acetazolamide e creatin monoidrato senza alcun miglioramento clinico o della gravità delle cisti cerebrali. Recentemente studi sperimentali (Teijido O. et al., 2004) hanno dimostrato la normalizzazione della espressione della proteina mutata in modelli animali dopo somministrazione di curcumina, un inibitore della Ca2+-ATPasi. La terapia dei soggetti con MLC ha quindi carattere sintomatico con utilizzo di farmaci antiepilettici in caso di epilessia, terapia fisica per migliorare le funzioni motorie e terapia educativa per i soggetti con compromissione cognitiva.

122



LEUCOENCEFALOPATIA

CON

CISTI

SUBCORTICALI

SENZA

MEGALENCEFALIA Sono sempre più numerose le evidenze a favore di una eterogeneità genetica della MLC (Blattner R. et al. 2003, Patrono C. et al. 2003) così come, nel corso degli ultimi anni si sono fatte più emergenti anche le segnalazioni relative a patologie spongiformi della sostanza bianca in assenza di megalencefalia. E’ sufficiente leggere gli atti della “question and answer session” della terza sessione del “Updates on specific leukodystrophies” del convegno “Neurobiology of disease in children” (pubblicate sul volume 18, Number 9 del Journal of Child Neurology del 2003) per rendersi conto di come la macrocrania sia elemento clinico indispensabile alla diagnosi di MLC, ma anche di come i massimi esperti sulla malattia ricevano sempre maggiori richieste a proposito delle forme in cui, pur in presenza di un quadro clinicamente similare, manca un aumento della circonferenza cranica. Solo nel corso degli ultimi anni è stato possibile identificare almeno due diverse entità cliniche caratterizzate dalla presenza di lesioni cistiche pur in assenza di macrocrania, ovvero la leucoencefalopatia cistica senza megalencefalia e la leucodistrofia cavitaria progressiva (descritta di seguito), ma sono ancora numerose le segnalazioni presenti in letteratura di leucodistrofie cavitarie micro o normocraniche di difficile inquadramento diagnostico. La leucoencefalopatia cistica senza megalencefalia venne descritta nel 1998 in tre pazienti di origini turche ed ha ricevuto, ad opera degli stessi autori, questa denominazione solo nel 2005 (Henneke et al. 2005) a seguito della descrizione della stessa in altri 15 pazienti. Gli aspetti alla MRI ed il decorso clinico differiscono significativamente da quelli propri della MLC1 così che essa può, pur in assenza di un deficit genetico noto, essere considerata a tutti gli effetti una patologia distinta.

123

Principali manifestazioni cliniche: I criteri diagnostici per questa patologia sono considerati essere: 1. Normocefalia o microcefalia 2. Grave ritardo psico-motorio ad esordio precoce 3. Cisti anterotemporali bilaterali su un quadro di interessamento diffuso della sostanza bianca, con relativo risparmio della sostanza bianca delle strutture cerebrali mediane. La malattia si manifesta precocemente, alla nascita o intorno ai diciotto mesi di vita, e presenta un decorso lentamente progressivo, quando non tendente alla stabilizzazione. I pazienti appaiono micro o normocranici, con o senza dismorfie facciali (“faccia a bambola”, fronte ampia, epicanto, ipertelorismo, anomalie della dorso nasale), in assenza di anomalie viscero-cutanee o scheletriche. Sono descritti, variamente associati, un ritardo delle acquisizioni motorie di gravità variabile (mancata acquisizione del controllo del tronco, oppure deambulazione con appoggio), atassia di grado medio, movimenti atetoidi, distonia, interessamento piramidale (diplegia o tetraparesi spastica), epilessia generalmente farmaco-responsiva (ad esordio fra i tre mesi e i 5 anni), nistagmo e compromissione uditiva, megalocornea. Le funzioni cognitive sono gravemente compromesse in buona parte dei pazienti con mancata acquisizione del linguaggio o con capacità di pronunciare poche parole o frasi. Alcuni pazienti manifestano alterazioni dell’umore con tratti aggressivo-autistici. Diagnosi: Alla MRI si evidenziano alterazioni della sostanza bianca sovratentoriale, iperintensa nelle sequenze T2 pesate ed ipointensa in quelle T1, con prevalente interessamento della sostanza bianca periventricolare e risparmio della sostanza bianca delle strutture mediane e cerebellari. Le lesioni cistiche sono tipicamente localizzate in corrispondenza della porzione anteriore dei lobi temporali con intensità di segnale comparabile a quella del CSF. 124

Alla H-MRS si evidenzia una riduzione del rapporto NAA/Cr specialmente in corrispondenza dei lobi parieto-temporali. In

letteratura

sono

presenti

numerose

segnalazioni

relative

a

patologie

leucoencefalopatiche caratterizzate da una associazione di cisti subcorticali anterotemporali, normo o micro-crania e decorso clinico relativamente benigno (Olivier et al., 1998, Battini et al., 2002, Levy Gomes A. et al, Wassmer E. et al., Grosso et al., 2005, Bodensteiner et al., 2006). •

LEUCODISTROFIA CAVITARIA PROGRESSIVA

Questa patologia è stata descritta per la prima volta nel 2005 (Naidu S. et al., 2005) in 19 pazienti appartenenti a 16 famiglie differenti anche per etnia. Rappresenta il secondo esempio di patologia di recente descrizione caratterizzata dall’associazione di una leucoencefalopatia spongiforme pur in assenza di macrocrania. Principali aspetti di genetica molecolare: Sebbene non si conosca la causa della malattia, la presenza di una ricorrenza familare e la comparsa in famiglie con alto tasso di consanguineità, fa supporre che si tratti di una malattia ereditaria autosomica recessiva. Il riscontro di elevati livelli di lattato nel liquor, nel sangue e nel tessuto cerebrale associati ad anomalie degli acidi organici urinari, fa ipotizzare la possibile origine mitocondriale della malattia sebbene gli studi sul mtDNA e sulla catena respiratoria siano risultati negativi. Manifestazioni cliniche: Il numero limitato di pazienti descritti non consente una definizione sindromica assoluta. La malattia sembra esordire in un’età compresa fra i 2 mesi ed i 3,5 anni con episodi acuti di irritabilità o di deficit neurologici, nel quadro di un disturbo a carattere progressivo e decorso variabile. Proprio sulla base della varietà sintomatologica e dell’impegno al neuroimaging sono state distinte una variante con

125

compromissione cerebrale moderata, una con impegno severo ed una a rapida progressione. 7 dei pazienti descritti sono morti in una età compresa fra gli 11 mesi ed i 5 anni. Variante con compromissione cerebrale moderata: esordisce nei primi due anni con un quadro di lieve disturbo dell’acquisizione del linguaggio sul quale si possono inserire episodi di difficoltà di deambulazione, generalmente associati ad episodi febbrili. Può essere presente un alterazione del tono dell’umore. Variante con compromissione cerebrale severa: esordisce più precocemente, primi mesi di vita, con atassia, irritabilità e crisi in opistotono. Possono essere presenti crisi epilettiche; col tempo si evidenzia un progressivo deterioramento motorio ed un importante deficit del linguaggio. Sono frequenti gli episodi acuti di irritabilità, spasticità, cianosi e deficit della ventilazione fino alla paralisi. Frequente è il decesso nei primi anni spesso per infezioni intercorrenti. Variante a rapida progressione: Compare più tardivamente, ma sempre nei primi anni di vita con voce nasale, disartria, atassia truncale di grado medio, difficoltà nella deglutizione e diplegia facciale. La malattia sembra evolvere con un quadro di debolezza muscolare, spasticità, disartria ed atassia che tendono progressivamente a stabilizzarsi. Diagnosi: Le caratteristiche essenziali per la diagnosi sono quelle che derivano dai dati del neuroimaging che evidenziano anomalie irregolari ed asimmetriche della sostanza bianca con degenerazione in ampie formazioni cistiche. L’evoluzione cistica coinvolge principalmente il corpo calloso, la sostanza bianca cerebrale e cerebellare ed il distretto midollare; anche se nelle fasi avanzate della malattia viene interessata l’intera sostanza bianca corticale e midollare con risparmio delle sole fibre ad U e

126

della sostanza grigia. Alla H-MRS è caratteristico il picco del lattato che, insieme alla presenza di lattato nel liquor e nel sangue, può essere d’aiuto, agli esordi della malattia, per la diagnosi differenziale rispetto alle patologie infettive, post-infettive e disimmuni. La biopsia cerebrale e l’autopsia permettono di evidenziare, in presenza di un peso cerebrale pressochè normale, un quadro multicavitario caratterizzato dalla presenza di lesioni cistiche multifocali di diametro anche oltre il centimetro, ben demarcate rispetto alla sostanza bianca adiacente; al microscopio queste lesioni sono confinate nella sostanza bianca. Lo studio istologico evidenzia, negli stadi precoci, un pallore del neuropilo con un certo grado di riduzione degli oligodendrociti; e nelle fasi più avanzate la totale scomparsa del neuropilo con perdita del normale rivestimento mielinico, scomparsa degli oligodendrociti e progressiva cavitazione. Sono presenti moderata gliosi ed, in alcuni casi, macrofagi a citoplasma fumoso o contenenti lamelle mieliniche. Diagnosi differenziale: Il quadro clinico all’esordio può porre problemi di diagnosi differenziale rispetto a patologie infettive del sistema nervoso (irritabilità, opistotono) o a patologie postinfettive e disimmuni. Alla comparsa delle alterazioni cistiche invece bisoga escludere la MLC1, le altre leucoencefalopatie cistiche normo o microcraniche, e la malattia di Alexander in stadio avanzato. •

IPOMIELINIZZAZIONE CON ATROFIA DEI GANGLI DELLA BASE E

DEL CERVELLETTO (H-ABC) L’ipomielinizzazione con atrofia dei gangli della base e del cervelletto è una leucodistrofia di recente descrizione, definita sulla base di un pattern MRI peculiare e caratterizzata, su un piano clinico, da disturbi del movimento di tipo

127

piramidale/extrapiramidale e da un ritardo mentale di grado variabile. Descritta per la prima volta nel 2002 dal gruppo della van der Knaap, la malattia è stata identificata in un totale di dieci pazienti (van der Knaap M.S., 2002; Mercimeck-Mahmutoglu S. et al., 2005; Wakusawa K. et al., 2006; Palma da Cunha Matta A. et al., 2007). In assenza di un test di laboratorio o genetico dirimente la malattia viene diagnosticata sulla base dei soli reperti di neuroimaging. Manifestazioni cliniche: L’esordio avviene in infanzia con un variabile grado di alterazione dello sviluppo motorio ed emergenza di un disturbo del movimento di origine extrapiramidale (rigidità, distonia, coreoatetosi), associata ad atassia e spasticità, senza un importante interessamento delle capacità cognitive. I soggetti affetti presentano un fenotipo clinico variabile sia in termini di severità che di evoluzione clinica. Alcuni mostrano un fenotipo particolarmente severo ad esordio nei primi mesi di vita con deficit visivi, anartria e ritardo/blocco dello sviluppo psicomotorio seguiti da spasticità e segni extrapiramidali (rigidità, distonia e movimenti coreoatetoidi), altri presentano un fenotipo ad esordio compreso fra gli 1-3 anni con minore compromissione cognitivomotoria, almeno nelle fasi iniziali dello sviluppo, e progressiva comparsa di spasticità, atassia, distonia, coreoatetosi e rigidità con alterazioni della deambulazione autonoma ad esordio e gravità variabili. Si associano solo secondariamente le difficoltà di apprendimento con declino cognitivo. In linea generale, i pazienti con la forma severa, presentano subito dopo la nascita uno scarso contatto visivo (con papille ottiche pallide) e assenza di sviluppo motorio, successivamente compaiono gli altri sintomi caratteristici, associati a microcrania (2U.I./ml) nel liquido cerebrospinale (in media 54 U.I./ml) e nel sangue (in media 9,2 U.I./ml), anche se il livello nel CSF è sempre molto più elevato di quello del sangue.

152

Istopatologia: A livello del SNC è presente una demielinizzazione diffusa non omogenea con astrocitosi, microinfarti cuneiformi, depositi calcifici, calcificazione della media e dell’avventizia nonché degli spazi perivascolari ed infiammazione delle leptomeningi. A livello cutaneo inclusioni tubuloreticolari endoteliali e, all’immunofluorescenza, depositi granulari di IgM a livello della membrana basale. Diagnosi differenziale: La diagnosi differenziale si pone nei confronti di un ampio spettro di patologie in quanto le manifestazioni cliniche di questa sindrome, almeno in fase iniziale, presentano elementi di aspecificità. La presenza di episodi febbrili spinge spesso a porre diagnosi di meningite od encefalite. Sono numerose poi le patologie nelle quali è possibile il riscontro di calcificazioni cerebrali. La diagnosi differenziale si pone con altre forme di encefalopatia ad esordio precoce: Infezioni congenite (TORCH)

MICS (microcefaliacalcificazioni intracraniche) o pseudoTORCH o sindrome di Baraitser-Reardon

Sindrome di Cockayne

Importante la diagnosi differenziale anche in relazione alla possibilità di trattamento terapeutico delle forme infettive

Condivide molti degli aspetti clinici (microcefalia, epatomegalia con elevazione delle transaminasi, trombocitopenia talvolta associata a porpora) e neuroradiologici (calcificazioni intracraniche). I dati relativi all’IFN-α in questa sindrome non sono noti ma è plausibile che questa sindrome comprenda uno spettro eterogeneo di disordini comprendenti anche forme di AicardiGoutières non diagnosticate. Forma di leucodistrofia autosomica recessiva con calcificazioni striocerebellari, facies tipica, sordità neurosensoriale, cataratta, distrofia della retina e fotosensibilità cutanea.

153

LES familiare

Lupus eritematoso neonatale

Esempio ne sono i due casi descritti da Dale et al. nel 2000, diagnosticati come LES familiare e che presentavano encefalopatia ad esordio precoce, calcificazioni intracraniche, geloni ed elevati livelli autoanticorpali per i quali si è posto il dubbio che si tratti di forme di Aicardi-Goutières. Sono stati descritti (Prendiville et al., 2004) casi di lupus eritematoso neonatale con calcificazioni dei gangli della base ed alterazioni della sostanza bianca

Sindrome di HoyeraalHreidarsson

Sindrome X-linked ad esordio precoce causata da una mutazione del gene DKC1. Si presenta con microcefalia, ipoplasia cerebellare e calcificazioni intracraniche associate a pancitopenia persistente.

Malattie mitocondriali

Sindrome di Leigh ed encefalopatia mitocondriale con calcificazioni intracraniche (Samson et al., 1994)

3-idrossibutirrico aciduria

Chitaya et al. nel 1992 hanno descritto due gemelli monozigoti in cui erano presenti dismorfie facciali, microcefalia, disordini di migrazione cerebrale e calcificazioni intracraniche congenite.

Terapia: La terapia ha essenzialmente carattere sintomatico e consiste nella fisioteraia respiratoria finalizzata alla prevenzione delle complicanze respiratorie, in una dieta caloricamente adeguata e nel trattamento delle convulsioni, quando presenti. Gli studi sperimentali (Kuijpers et al., Barth et al.) hanno evidenziato un abbassamento dei livelli di interferone in seguito a terapia corticosteroidea (metilprednisolone), anche se l’efficacia sul piano clinico di questa terapia non è ancora dimostrata. •

SINDROME 18q- (SINDROME DI DE GROUCHY)

La sindrome 18q-, o sindrome di De Grouchy, è una malattia derivata da una anomalia cromosomica consistente in una macrodelezione della porzione distale del braccio lungo del cromosoma 18. Descritta originariamente da De Grouchy nel 1964, 154

venne definita nei suoi principali aspetti clinici da Lejeune due anni più tardi. Nonostante l’estrema variabilità fenotipica, è possibile delineare le caratteristiche principali della malattia: ritardo mentale e dello sviluppo, deficit di crescita, dismorfismi craniofacciali (ipoplasia della porzione media del volto, rilievo delle bozze frontali, bocca “a carpa”), malformazioni degli arti (in particolare deformità dei piedi), disordini dei movimenti oculari, ipoplasia genitale, e sintomi neurologici vari. Principali aspetti di genetica molecolare: La malattia è determinata da una macrodelezione di lunghezza variabile (intorno ai 2 Mb) in corrispondenza della regione q21.1-21.3 del cromosoma 18 ed il gene, la cui aploinsufficienza è responsabile della malattia, è ancora ignoto anche se l’attenzione si è negli ultimi anni concentrata su due geni contenuti in questa regione: quello della proteina basica della mielina (MBP) e quello del recettore della galanina (GALNR). Gli studi di genetica molecolare ed in particolare le tecniche di ibridizzazione in situ a fluorescenza (FISH), gli studi citogenetici, le tecniche di clonazione e sequenziamento del gene, nonchè lo studio dei markers e dei microsatellite, hanno però permesso di evidenziare come la mutazione, in origine considerata una delezione terminale de novo, non presenti caratteristiche di uniformità all’interno della popolazione dei soggetti affetti. Brkanak et al. nel 1998 hanno evidenziato, tramite l’utilizzo di markers genici, come su 35 pazienti affetti 5 presentassero un riarrangiamento criptico come base del successivo processo di delezione e 3 conservassero la porzione distale del braccio lungo del cromosoma 18. Nel 2003 (Gunn S.R. et al. 2003) è stato descritto un caso di sindrome 18q- nel quale lo studio citogenetico non aveva evidenziato alcuna anomalia cariotipica apparente. L’aspetto clinico altamente suggestivo ha permesso di evidenziare, tramite studi FISH e di ibridizzazione (CGH

155

array), la presenza di una microdelezione criptica del cromosoma 18q (del 18q22.3qter) associata ad una translocazione 4q-18q di 3,7Mb. Manifestazioni cliniche: La

malattia

presenta

una

notevole

variabilità

fenotipica

caratterizzata

dall’associazione di una ampia gamma di sintomi sui quali predominano il ritardo mentale, il deficit di crescita (dovuto secondo recenti studi ad anomalie del GH o dell’asse dell’IGF1 e dell’IGFBP3 la cui genesi permane sconosciuta e per i quali si è ipotizzata l’esistenza di un gene che codifichi per un fattore di regolazione della crescita proprio in corrispondenza del 18q), l’ipotonia, le anomalie cranio-facciali (compresa la microcefalia) ed un ampio spettro di quadri dismorfici come evidenziato nella tabella 5: Caratteristiche Ritardo mentale* Ritardo di crescita (< del 5 percentile) Volto spianato Ipotonia Antielice prominente

% di Caratteristiche pazienti 93 Anomalie del secondo dito 77 Strabismo

% di pazienti 21 20

68 59 58

19 14 12

36

Macrognazia Capelli sottili Ampiezza del diametro dei capezzoli Carnosità della punta delle dita Convulsioni Ginocchio varo Inclinazione verso l’alto del taglio dell’occhio Impianto basso delle orecchie Brachicefalia

36 35

Labioschisi Ernia ombelicale

8 7

35

6

33

Formazioni nodulari ai lati della bocca Coloboma

4

30

Eczema

4

Genitali maschili anomali

57

Microcefalia Bocca “a carpa” Deformità dei piedi

56 56 51

Atresia/stenosi del canale uditivo Malattie cardiache congenite Increased whorl patterns Displasia delle piccole labbra Dita affusolate

39

Pollici ad impianto prossimale Nistagmo

11 12 9 9 8 8

156

Anomalie palatali Schisi

30 12

Accentuazione dell’angolo della volta Uvula bifida Epicanto

15 3 29

Deficit di IgA Deficit acustici

27 26

Ipertelorismo

26

Pallore del disco ottico Fossette cutanee

23 23

Dorso nasale ampio Pieghe scimmiesche

23 23

Ernia inguinale Accentuazione delle bozze frontali Clinodattilia

4 4

Displasie dentarie Ritardo di chiusura delle fontanelle Corea Presenza di uno spazio anomalo fra primo e secondo dito Attaccatura bassa dei capelli in sede occipitale Scoliosi Presenza di “voglie” color fragola sul volto Collo corto Disturbi di alimentazione

4 4

4

3 3

3 3 3 3 3

Tabella 5:(tratto da : “Chromosome 18 Clinical Research Center at the University of Texas Health Science Center at San Antonio”, materiale tratto dal World Wide Web)

Sono stati descritti, in singoli pazienti, anche ipoplasia dell’orecchio medio, macchie da sfregamento, presenza di costa cervicale, presenza di coste sovrannumerarie, dita tozze, cataratta, rene a ferro di cavallo, ptosi palpebrale, psoriasi, cifosi, agenesia renale, deficit di IgM, sarcoma di Ewing extrascheletrico, astrocitoma cerebellare, distrofia dei coni e dei bastoncelli della retina, asma, malattia cronica granulomatosa, artrite cronica. Sul piano neurologico in particolare predominano infine i seguenti quadri: Caratteristiche Dismielinizzazione nel SNC Disturbi del linguaggio Ipotonia Riflessi tendinei assenti o diminuiti Deformità del piede Sordità Ritardo mentale (QI100 casi) e descritta in alcuni pazienti negli Stati Uniti d’America. Principali aspetti di genetica-molecolare: La malattia, a trasmissione autosomica recessiva, può essere determinata dalle mutazioni del gene TREM2, localizzato sul cromosoma 6p21.1, e del gene TYROBP sul cromosoma 19q13.1. Il gene TREM2, formato da cinque esoni, codifica per una proteina di 230 amminoacidi che funge da recettore superficiale di membrana formando un complesso con una proteina transmembranaria, la DAP12. Il complesso TREM2-DAP12 avrebbe una funzione nel processo di differenziazione degli osteoclasti e di attivazione delle cellule dendritiche di derivazione monocitaria. Il ruolo della proteina nel SNC rimane invece ignoto. Sono note numerose mutazioni in omozigosi, la più frequente delle

160

quali (233G→A) determina un arresto precoce della traduzione proteica con perdita della porzione transmembranaria ed intracitoplasmatica della proteina. Il gene TYROBP (DAP12), di cinque esoni, codifica per una proteina di 113 amminoacidi con funzione di proteina adattatrice transmembranaria che svolge funzioni di attivatore delle cellule di origine mieloide e delle celleule NK. Sulla membrana citoplasmatica la DAP12 viene espressa sotto forma di omodimero disulfide-legato che si lega ad ulteriori recettori membranari come la TREM1, la TREM2, il SIRP-BETA1, l’NKp44, il MDL-1, il CD94, la KIR2DS2, l’NKG2C e l’NKG2D. Il dominio citoplasmatico della proteina contiene un motivo ITAM (immunoreceptor tyrosine-based activation motif) che, a seguito dell’attivazione, viene fosforilato e lega le tirosin-chinasi citoplasmatiche SYK e ZAP70 con conseguente mobilizzazione del calcio intracellulare. Sono note diverse mutazioni fra le quali almeno tre delezioni esoniche, una mutazione puntiforme ed una delezione puntiforme oltre ad una serie di mutazioni isolate in singole aggregazioni familiari. Manifestazioni cliniche: Il decorso clinico della malattia può essere suddiviso in quattro stadi fondamentali: - fase di latenza: Lo sviluppo è inizialmente nella norma senza alcun segno o sintomo di malattia. - fase dell’interessamento osseo: La malattia si manifesta intorno alla terza decade di vita con dolori e fragilità osteoarticolare, prevalentemente alle caviglie ed ai piedi. Le microfratture, che generalmente conseguono a distorsione o traumi minori, vengono diagnosticate qualche anno dopo ed interessano prevalentemente caviglie e polsi. Alcuni pazienti possono sviluppare sintomi neurologici di terza fase anche in assenza di storia clinica di interessamento osseo.

161

- fase dell’impegno neurologico precoce: Intorno alla quarta decade di vita compaiono alterazioni progressive della personalità con perdita della capacità di giudizio, compromissione sociale e numerosi casi di tentato suicidio. Compare una sindrome pre-frontale con euforia, perdita dell’inibizione sociale, disturbi di concentrazione, perdita delle capacità di insight, disinibizione della libido e comportamenti di persistenza motoria, fino alla perdita di iniziativa e delle attività concettuali. Si associano segni di interessamento del primo motoneurone con spasticità e riflesso cutaneoplantare positivo. Alla stessa età si manifestano segni di interessamento delle funzioni mnesiche (Benton’s visual retention test, ten-word test e WMSc) di minore gravità rispetto ai disturbi di personalità, ma spesso seguiti da afasia motoria, agrafia, acalculia ed aprassia che però si manifestano prevalentemente nelle fasi avanzate di malattia. I soggetti affetti presentano anche disprassia posturale con posture anomale e movimenti coreo-atetoidi o mioclonici. I soggetti che raggiungono i quaranta anni possono presentare epilessia ed impotenza con disturbi della libido e segni di incontinenza urinaria. - fase dell’impegno neurologico tardivo: Nelle fasi avanzate di malattia i pazienti perdono la capacità di deambulazione ed evolvono progressivamente verso uno stato vegetativo con comparsa e disinibizione dei riflessi arcaici di grasping, dei movimenti buccali automatici e dei riflessi di suzione. L’exitus avviene intorno alla quinta decade. Diagnosi: Clinica: La combinazione dei seguenti elementi clinici è fortemente suggestiva per la diagnosi:

162



Lesioni policistiche e fratture del polso e della caviglia a seguito di traumi minori. Lesioni cistiche e perdita dell’osso trasecolare sono particolarmente frequenti nelle falangi e nel carpo e tarso.



Sindrome del lobo frontale dopo la quarta decade di vita con euforia e disinibizione sociale.



Quadro demenziale presenile a partire della quarta decade con sintomi neurologici associati e decesso intorno alla quinta decade.

Biopsia ossea: Cisti ossee contenenti materiale lipidico con le caratteristiche di membrane lipidiche di 1-2µm di spessore frammiste a materiale lipidico amorfo. Neuroimaging: Alla TC ed al MRI si evidenzia atrofia cerebrale e cerebellare di vario grado, che precede i sintomi neurospichiatrici, con calcificazione bilaterale dei gangli della base ed ipointensità nelle sequenze T2 pesate del putamen e dei talami. Dopo la comparsa dei sintomi neurologici si evidenzia una iperintensità diffusa della sostanza bianca in T2 , principalmente a livello dei lobi frontali, con risparmio delle fibre arciformi. EEG: L’EEG è normale nelle fasi precoci di malattia, ma con l’avanzamento del quadro neurologico si evidenzia un’accentuazione dell’attività theta (dapprima ritmica a 6-8 Hz e prevalentemente centrtemporale e poi diffusa e lenta) e delta. Nelle fasi tardive possono evidenziarsi onde irritative multiple. Neuroistopatologia: Lo studio neuropatologico evidenzia un quadro di atrofia cerebrale diffusa con prevalente interessamento frontale ed ipoplasia del corpo calloso. La sostanza bianca profonda è marcatamente ridotta ed i nuclei della base sono ipoplasici con interessamento del caudato in particolare che mostra perdita neuronale, proliferazione astrocitaria ed ipertrofia. Tutti i pazienti hanno un idrocefalo ex vacuo. Sono presenti

163

depositi calcifici nei nuclei della base (preminentemente putamen e pallido) e degenerazione talamica, mentre nel centro semiovale sono presenti perdita assonale e mielinica e reazione astrocitaria. E’ descritto inoltre un quadro di attivazione microgliale diffusa con alterazione arteriolare, assottigliamento della parete vascolare e restringimento luminale. All’istopatologia si evidenziano neuroni con aspetti di cromatolitisi senza inclusioni citoplasmatiche neuronali o gliali. Diagnosi differenziale: L’associazione di demenza frontale presenile associata alle caratteristiche lesioni policistiche ossee rende in genere semplice la diagnosi differenziale rispetto ad altre forme demenziali frontali familiari e non come la malattia di Pick, la degenerazione frontale lobare non-specifica, la demenza frontotemporale e parkinsonismo associati al cromosoma 17 (FTDP-17) e le taupatie. Terapia: La terapia ha carattere sintomatico e finora non sono stati individuati intereventi terapeutici utili a rallentare la progressione della malattia. Gli interventi chirurgici ed ortesici si sono dimostrati utili nel trattamento delle fratture mentre l’epilessia, che sembra peggiorare il quadro demenziale, è trattata farmacologicamente. •

SINDROME DI SJÖGREN-LARSSON (SLS)

La malattia di Sjögren-Larsson è un disordine neurocutaneo a trasmissione autosomica recessiva caratterizzato dall’associazione di ittiosi, diplegia o quadriplegia spastica e ritardo mentale. Descritto per la prima volta nel 1957 nella popolazione della contea di Vasterbotten in Svezia, sulla base di un probabile effetto fondatore, è una malattia a diffusione mondiale con una prevalenza di 0,4 casi su 100.000. Si tratta di una malattia determinata da un deficit congenito del metabolismo lipidico

164

determinato da un’alterazione di un enzima a localizzazione microsomiale, la FALDH, che catalizza la conversione delle aldeidi grasse ad acidi grassi. Principali aspetti di genetica-molecolare: Pigg et al nel 1994 a seguito di uno studio di linkage evidenziarono una associazione allelica fra la SLS e la porzione pericentrica del cromosoma 17. Nel 1996 De Laurenzi et al. identificarono come responsabile della patologia le mutazioni del gene FALDH o ALDH10 che recentemente è stato ridenominato ALDH3A2. Il gene ALDH3A2 è lungo 31kb ed è costituito da 11 esoni numerati da 1 a 10 più un esone ulteriore (9#x2019) situato tra l’esone 9 e l’esone 10. Uno splicing alternativo in corrinspondenza dell’esone 9#x2019 determina la formazione di due isoforme proteiche che differiscono nella porzione C-terminale: la forma più rappresentata consiste in una proteina di 485 aa. mentre l’altra, di 508 aa, costituisce il 10% del totale. Oltre allo splicing alternativo sono identificabili tre ulteriori trascritti (2.0, 3.8 e 4 Kb) che derivano da un differente riconoscimento di un sito di poliadenilazione. Allo stato attuale sono note circa una settantina di mutazioni responsabili della malattia, rappresentate nella maggior parte dei casi da mutazioni missense; sono presenti anche mutazioni di splicing con exon-skipping, sostituzioni nucleotidiche, duplicazioni, delezioni ed inserzioni nucleotidiche o delezioni più ampie (la massima delezione descritta ha interessato un tratto di 6kb). Sono stati descritti numerosi polimorfismi del gene, per lo più intronici, le cui influenze sull’espressione del gene non sono ancora note. Per quanto concerne la sua attività metabolica la FALDH appartiene alla grande famiglia delle aldeide deidrogenasi (ALDH) codificate, nell’essere umano, da almeno 19 geni differenti. La FALDH in particolare catalizza l’ossidazione NAD-dipendente

165

delle aldeidi alifatiche sature ed insature contenenti da 6 a 24 atomi di carbonio. L’enzima ossida inoltre le aldeidi alifatiche a catena ramificata ed agisce anche sui gruppi ω-carbonilici del leucotriene B4. Da ultimo la FALDH, oltre ad agire sui substrati aldeidici liberi, interagisce con la deidrogenasi degli alcooli grassi per formare la ossidoreduttasi NAD dipendente degli alcool grassi (FAO) che catalizza l’ossidazione degli alcooli grassi ad acidi grassi (Figura 20).

Figura 20: Ruolo della FALDH e del complesso FAO nel metabolismo degli acidi grassi (tratto da Rizzo W.B., 2007)

La definizione dei meccanismi biochimici alla base dei sintomi della SLS è resa particolarmente complessa dal coinvolgimento della FALDH in diversi pathways biochimici connessi col metabolismo degli acidi grassi e dal fatto che ciascuno di questi può rivestire importanza differente nei diversi apparati. Manifestazioni cliniche: La malattia presenta un ampio spettro di manifestazioni cliniche con un prevalente interessamento neurocutaneo.

Crescita Testa e collo

Sintomi e segni Bassa statura Occhi: macule bianche scintillanti all’esame del fondo oculare, degenerazione maculare, retinopatia pigmentaria, opacità corneali superficiali, fotofobia. Denti: ipoplasia dello smalto

166

Apparato scheletrico

Cute, unghie e capelli

SNC

Spina dorsale: cifosi Mani: ispessimento palmare Piedi: ispessimento della pianta Cute: ittiosi pruriginosa Unghie: normali Capillizio: normale Ritardo mentale Spasticità Epilessia Quadro demielinizzante

Le manifestazioni cutanee presentano una ampia variabilità della severità, in parte attribuita alla possibile presenza di fattori genetici o ambientali in grado di fungere da “compenso” al deficit metabolico. E’ stata descritta la progressività della degenerazione maculare mentre l’impegno neurologico sembra presentare carattere di stabilità o di progressione lenta. Diagnosi: La diagnosi può essere sospettata già sulla base del quadro clinico e dell’associazione di ittiosi, sintomi neurologici ed impegno della sostanza bianca. Lo studio dei fibroblasti o dei leucociti in coltura ed in particolare il dosaggio dell’exadecanolo (aumento del contenuto in exadecanolo misurabile anche dopo saggio con palmitato radiomarcato), la cui ossidazione è compromessa dal deficit della FALDH, costituisce un test mininvasivo che consente di porre diagnosi. L’alto costo e la difficile reperibilità dei metaboliti e le complicazioni relative all’utilizzo di componenti radiomarcate, rendono però queste tecniche non particolarmente adatte all’utilizzo routinario. Recentemente van den Brink et al. hanno evidenziato come la FALDH svolga anche una funzione nel metabolismo del fitolo (un acido grasso a catene ramificata presente in natura soprattutto nei composti della clorofilla) ed hanno dimostrato la possibilità di diagnosticare la SLS mediante incubazione di fibroblasti in coltura con fitolo e NAD+. La bassa concentrazione, misurata tramite gas

167

cromatografia/spettrometria di massa, in acido fitenico (derivato dal fitolo per azione della FALDH) costituisce un test più facilmente eseguibile e meno dispendioso. La diagnosi di certezza deriva dallo studio genetico della malattia, ancora a carattere, per lo più, sperimentale. Neuroimaging: Grande importanza hanno le tecniche di neuroimaging che, adeguatamente sostenute dalla clinica, possono fornire importanti informazioni per l’orientamento diagnostico. All’MRI, che risulta però negativa nel periodo immediatamente post-natale, si evidenzia una iperintensità di segnale nelle sequenze T2 pesate, che presenta una ampia varietà di distribuzione; in alcuni casi c’è un interessamento diffuso della sostanza bianca ed altri è possibile evidenziare la presenza di lesioni isolate con tendenza alla confluenza. Le fibre ad U, il cervelletto e la sostanza grigia sono in genere risparmiate. La H-MRS mostra una riduzione del picco NAA e, con TE bassi, un picco lipidico a 0,9 ed 1,3 ppm, nella sostanza bianca colpita dalla malattia con una riduzione del rapporto lipidi/Cr.

168

1.2

LEUCODISTROFIA

CON

ATASSIA,

SORDITA’

E

CARDIOMIOPATIA (ADCL) Si tratta di un nuovo fenotipo clinico di malattia neurodegenerativa, trasmessa con meccanismo autosomico recessivo, che non rientra fra le leucodistrofie fino ad ora segnalate in letteratura. L’esordio è precoce, tra i 2 e i 5 anni di età, caratterizzato da una atassia lentamente progressiva. Successivamente si manifesta una ipoacusia neurosensoriale che evolve in pochi anni in una sordità completa. Il quadro clinico è completato da un interessamento della funzionalità epatica, da un lento deterioramento sul piano motorio con comparsa di segni di origine piramidale, e dallo sviluppo di una cardiomiopatia a rapida evoluzione che porta i pazienti all’exitus entro la seconda decade di vita. In alcuni casi è segnalato anche un interessamento del sistema nervoso periferico. Le capacità cognitive restano conservate in un numero ridotto dei pazienti, la maggioranza dei quali invece va incontro ad un lento deterioramento mentale. La risonanza magnetica mostra una alterazione diffusa della sostanza bianca, con iperintensità nelle sequenze T2 pesate. La spettroscopia non evidenzia picchi patologici, ma indica uno stato di danno neuronale (incremento del mioinositolo, riduzione del picco di N-acetil-aspartato).

169

EXCURSUS METODOLOGICO-CLINICO DEL LAVORO SVOLTO ED OBIETTIVI DELLA RICERCA

2.0 Obiettivi. Gli obiettivi della presente ricerca sono stati due: - raccolta della casistica - individuazione del gene

2.1

Excursus

metodologico-clinico.

Il

presente

lavoro

ha

avuto

inizio

dall’osservazione clinica di tre soggetti affetti dalla stessa patologia che presentavano nel tempo la stessa evoluzione e decorso. Lo studio della letteratura ha permesso di escludere una condizione già nota. Trattandosi quindi di una nuova leucodistrofia, il nostro primo obiettivo è stato quello di raccogliere più informazioni possibili sulla famiglia iniziale, ma soprattutto di reperire altri casi simili. Abbiamo quindi cercato di divulgare, attraverso congressi internazionali di neurologia infantile (2003: 5th Congress of the European Pediatric Neurology Society EPNS, Taormina, Italy; 2004: Le leucodistrofie da causa indeterminata, Congresso Nazionale di Pediatria, Amians, Francia; 2006: 10th International Child Neurology Congress, ICNA Montreal Canada) o di metabolismo (2007: Congresso Medico Congiunto SIMGePed – SISMME – SISN: malattie genetiche e metabolitiche in pediatria: diagnosi, prevenzione e assistenza) e tavole rotonde organizzate dai centri europei sulle leucodistrofie (2004, Paris; 2005, Clermont-Ferrand), le caratteristiche cliniche dei nostri pazienti, per poter così informare il maggior numero di medici di questa nuova patologia che era oggetto di studio genetico. E’ stato così possibile reperire gli altri 4 casi, due provenienti dall’Istituto Carlo Besta di Milano (Dott.ssa G.Uziel), ed altri due dall’Hôpital Saint-Vincent-de-Paul di Parigi

170

(Dott.ssa D.Rodriguez). Successivamente, attraverso l’analisi dell’albero genealogico, si è evidenziato un legame di parentela tra questi pazienti, di origini slave, ma nomadi. Il nostro secondo obiettivo è stato quello di determinare geneticamente questa nuova condizione clinica. Il primo passo è stato di effettuare uno studio di linkage, con il DNA raccolto da tutti gli individui appartenenti alla prima famiglia presa in esame, che ha identificato il locus legato alla malattia. Successivamente, l’analisi di sequenza diretta dei geni all’interno della regione selezionata ha permesso di stabilire la mutazione responsabile, e quindi il gene coinvolto. Mutazione che è stata in un secondo tempo confermata in altri 4 casi appartenente ad una seconda famiglia. Il lavoro in corso stabilisce la base per la scoperta della funzione di questo gene non conosciuto al fine di cercare il meccanismo eziopatologico responsabile di questa nuova leucodistrofia e di incrementare allo stesso tempo le nostre conoscenze sul genoma umano.

171

MATERIALI E METODI Il presente lavoro di dottorato si è svolto presso la II Università di Roma “Tor Vergata”, in collaborazione con l’Unità Inserm U384 ‘Interactions génétiques et cellulaires au cours de la différentiation’, Faculté de Médicine, Clermont-Ferrand Cedex, France, ed il laboratorio di Biologia Molecolare dell’Ospedale Pediatrico Bambino Gesù di Roma, dove è stato effettuato lo studio genetico. 3.0 CAMPIONE DI SOGGETTI ESAMINATO Sono stati presi in esame 7 pazienti (5 maschi e 2 femmine), appartenenti a due distinte famiglie. Lo studio ha coinvolto inoltre anche 21 soggetti sani appartenenti alla prima famiglia. 3.1 ESTRAZIONE “RAPIDA” DEL DNA GENOMICO DA SANGUE PERIFERICO A 5ml di sangue, si aggiungono 5 ml di TKM1, una soluzione stock preparata in laboratorio e costituita da Trisma base, KCl, MgCl2 ed EDTA alle opportune concentrazioni che ha il compito di lisare i globuli rossi. Si aggiungono alla miscela (sangue e TKM1) 125 µl di Nonidet P40, anch’esso per lisare le emazie. Si mescola bene per inversione completa della provetta fino alla completa dissoluzione del NP40. Il sangue viene poi centrifugato a 2.200 r.p.m. (numero di giri al minuto) in una centrifuga da tavolo a temperatura ambiente per ottenere la separazione del siero dalla frazione corpuscolata del sangue. Dopo la centrifugazione si scarta il sopranatante e nel fondo di essa si rende evidente un pellet corrispondente ai nuclei cellulari. Il pellet viene ulteriormente lavato per togliere ulteriori residui di globuli rossi, risospendendolo in 5 ml di TKM1 e di nuovo centrifugato come descritto sopra. Si scarta di nuovo il sopranatante e, successivamente si aggiungono al pellet 800 µl di TKM2 e 50 µl di SDS al 10%. Questa sospensione viene incubata in un bagnetto

172

termostato a 55°C per 10-15 minuti. L’SDS è un forte detergente che permette, insieme al TKM2, la precipitazione delle proteine e prepara le cellule all’estrazione del DNA. Dopo l’incubazione si aggiungono 300 µl di NaCl 6M. E’ a questo punto che gli acidi nucleici escono dalla cellula e, dopo centrifugazione alla velocità massima per 15 minuti, saranno presenti nel sopranatante, mentre un pellet nel fondo sarà costituito dalle proteine. Quindi si raccoglie il sopranatante contenente il DNA avendo cura di non toccare i frammenti di pellet che contengono le proteine e si trasferisce in una falcon contenente due volumi di etanolo al 100% (per far precipitare il DNA). Poi si inverte delicatamente la provetta fino alla comparsa di una piccola matassa di DNA. Con una pipetta “pasteur” si rimuove il DNA, si trasferisce in una provetta eppendorf da 1.5 ml e si aggiunge 1 ml di etanolo freddo al 70%. Si centrifuga alla massima velocità per 5 minuti, si getta il sopranatante e si lascia il pellet di DNA ad asciugare all’aria. Infine il DNA viene risospeso in H20 sterile in quantità adeguata a quella del quantitativo di DNA. 3.2 AMPLIFICAZIONE DI SEQUENZE SPECIFICHE MEDIANTE PCR La PCR (Polymerase Chain Reaction), ideata nel 1983 da Kary B. Mullis, costituisce l’innovazione biotecnologica piu’ importante degli ultimi 20 anni. La reazione polimerasica a catena può essere definita come una reazione di amplificazione in vitro di un segmento specifico di DNA. Nella reazione sono coinvolti tre segmenti di acidi nucleici: lo “stampo” di DNA a doppia elica che deve essere amplificato e due primers complementari a zone specifiche sulle opposte catene di DNA. Ogni primer innesca la sintesi di catene verso l’altro primer. Il risultato è l’amplificazione della regione di DNA compresa tra i due primers. Inoltre sono presenti una componente proteica (una DNA polimerasi), appropriati deossiribonucleotidi, un tampone e dei sali. L’enzima inizialmente utilizzato era

173

facilmente distrutto dal calore e, di conseguenza, doveva essere aggiunto durante ciascun ciclo della reazione; la polimerasi attualmente utilizzata (Taq polimerasi), estratta da un batterio termofilo (thermus acquaticus) è invece termoresistente ed è stabile e attiva alle alte temperature e, quindi, può essere aggiunta solo all’inizio del processo. Un tipico ciclo di PCR comprende le seguenti fasi: 1.

Denaturazione mediante calore del DNA a doppia elica. La

temperatura e il tempo di questa fase dipendono dal mezzo di reazione e dalla composizione in basi, dalla lunghezza e dalla quantità del DNA bersaglio. 2.

Ibridazione dei primers (annealing). Le condizioni di temperatura di

questa fase dipendono dalla Tm ( temperatura di melting), quindi dalla composizione in basi dei primers stessi. Per primers fino a 25 basi la Tm può essere calcolata secondo la seguente relazione: Tm = 2 °C (A+T) + 4°C (G+C) –5°C La durata di questo step deve essere scelta in base alla lunghezza e alla composizione dei primers. 3.

Elongazione della catena di DNA. La temperatura di estensione dei

primers corrisponde a quella ottimale per l’enzima impiegato. Per la Taq polimerasi la temperatura generalmente utilizzata è di 72°C; a questa temperatura la Taq polimerasi è capace di incorporare circa 1000 nucleotidi al minuto. Il tempo di estensione dipende, principalmente, dalla lunghezza della sequenza che deve essere amplificata. La reazione ha un andamento esponenziale, dato che ad ogni cicli gli stessi prodotti di amplificazione fungono da substrato per i cicli successivi. Sono sufficienti 25-30 cicli per ottenere milioni di copie della sequenza d’interesse.

174

3.3 ELETTROFORESI SU GEL Uno dei primi e più semplici metodi utilizzati per la rivelazione del DNA amplificato consiste nella corsa elettroforetica in un campo elettrico a intensità e direzione costante, su gel d’agarosio. In sostanza un gel può essere immaginato come una rete molecolare attraverso le cui maglie si fanno migrare le macromolecole sotto l’azione di un campo elettrico. La velocità di migrazione elettroforetica di una molecola in un gel d’agarosio dipende da più parametri quali il peso molecolare, la conformazione dell’acido nucleico, la concentrazione dell’agarosio, la corrente applicata e la temperatura. In generale si può dire che la velocità di migrazione del DNA nella matrice del gel è inversamente proporzionale al log10 del numero di coppie di basi e quindi alla grandezza del frammento di DNA amplificato. In questo lavoro le molecole di DNA di interesse sono state separate su gel d’agarosio al 1%, preparato sciogliendo, su una piastra riscaldante, 1g di agarosio in 100 ml di tampone TBE 1X (tris-borato e acido borico 0.089 M ed EDTA 0.001 M) nel quale viene aggiunto il giusto quantitativo di etidio bromuro. L’agarosio viene bollito poco prima dell’uso e versato in apposite vaschette formatrici in cui viene inserito un pettine per formare i pozzetti di semina. Una volta solidificato a temperatura ambiente, si toglie il pettine e si trasferisce la vaschetta contenente il gel nella vasca elettroforetica in cui è presente il tampone di corsa; quindi si seminano le PCR nei pozzetti e si applica il campo elettroforetico che è di circa100 mV. L’etidio bromuro del tampone è un colorante fluorescente contenente un gruppo planare che ha la capacità di intercalarsi tra le basi del DNA. L’etidio bromuro legato al DNA ha un massimo di assorbimento alla lunghezza d’onda di 302 nm e, sottoposto ad illuminazione ultravioletta mediante un transilluminatore, emette una fluorescenza

175

rosa/arancione consentendo così la visualizzazione delle bande che hanno migrato lungo il gel. 3.4 SEQUENZIAMENTO AUTOMATICO La sequenza nucleotidica è stata ottenuta con il metodo di Sanger (Sanger 1977) ossia con il “metodo della terminazione di catena”. Questo metodo implica la formazione, a partire dal prodotto di PCR precedentemente purificato, di un nuovo strand di DNA tramite la sintesi in vitro (PCR di sequenza) ad opera della DNA polimerasi. La sintesi inizia a partire da un oligonucleotide sintetico che viene utilizzato come primer, contenente sequenze complementari ad una regione stampo. La polimerizzazione termina con l’incorporazione di un analogo dei nucleotidi (dideossinucleotide). Usando una opportuna miscela di deossinucleotidi e dideossinucleotidi marcati o fluorescinati, si ha la formazione di una popolazione eterogenea di catene di DNA, in quanto ogni qualvolta viene incorporato un dideossinucleotide l’elongazione della catena cessa. Quattro reazioni separate, contenenti ciascuna un differente dideossinucleotide, permettono di determinare la sequenza nucleotidica. Le differenti catene che si sono formate possono essere visualizzate, dopo essere state purificate, tramite elettroforesi su un gel denaturante. Nel presente lavoro, i prodotti di PCR sono stati purificati mediante Quiaquick Purification Kit (Quiagen) e marcati con fluorescenza con Big Dye Terminator Cycle Sequencing Kit (PE Applied Biosystems). Le reazioni di sequenza sono state purificate con Centristep e caricate su un gel di poliacrilamide denaturante al 4% che è stato analizzato sul sequenziatore automatico ABI PRISM 377 (Parkin Elmer). 3.5 STUDIO DI LINKAGE GENETICO Lo studio di linkage è stato fondamentale per la conoscenza della mappa genetica del genoma umano ed è costantemente usato per la diagnosi molecolare. La distanza

176

genetica, espressa in centimorgan (cM), è una misura della probabilità di un crossover tra due loci, cioè due loci sono lontani 1 cM se esiste una possibilità su cento di un crossover tra loro durante la meiosi (in media ci sono 30-35 crossover durante la meiosi nei soggetti di sesso maschile, e probabilmente il doppio in quelli di sesso femminile). Inizialmente, la praticabilità dell’analisi di linkage umano è stata rivoluzionata dalla dimostrazione dalla variabilità della taglia dei frammenti generati dalla digestione del normale DNA umano con le endonucleasi di restrizione. Questi frammenti di restrizione che misurano i polimorfismi (RFLPs) sono la conseguenza dei polimorfismi presenti nella sequenza di DNA e sono ereditati con meccanismo Mendeliano. Gli enzimi di restrizione e la tecnica del Southern blotting rendono possibile l’utilizzo di questi polimorfismi come markers genetici per siti all’interno del genoma. A livello del DNA non codificante si trovano brevi sequenze sparse in tutto il genoma costituite da 1-5 coppie di basi ripetute un certo numero volte tipo (CA)n, (GCC)n, (GATA)n chiamate short tandem repeat (STR) o microsatelliti; il numero di ripetizioni in un dato STR è diverso da persona e persona, ma è trasmesso di genitore in figlio secondo i rigidi meccanismi dell'ereditarietà mendeliana. Questo tipo di polimorfismo è evidenziabile amplificando il DNA con coppie di primers disegnati sulla regione del DNA che affianca la porzione microsatellite e rilevabile mediante tecniche elettroforetiche. Oltre a questi polimorfismi di lunghezza, nel DNA esiste anche un altro tipo di polimorfismo detto di sequenza; il caso più semplice di tale polimorfismo è rappresentato dalle mutazioni puntiformi (single nucleotide polymorphism, SNP). In

177

questo caso,il segmento di DNA differisce in 2 individui per la sostituzione di una singola base. Una caratteristica essenziale dell’analisi di linkage è data dal fatto che i markers del DNA presentano differenti alleli sui markers dei locus di interesse, così che i due cromosomi dello stesso individuo possano essere distinti. I sistemi molecolari per l’analisi del polimorfismo genomico si differenziano per il tipo di sequenze analizzate e/o per il tipo di tecnica impiegata. 3.6 DNA-POOLING Si tratta di un metodo di analisi genetica, che richiede un sistema di analisi computerizzato specifico e l’utilizzo di marcatori di polimorfismi detti “short tandem repeat” (STR) che ricoprono l’intero genoma umano, e che permette di valutare la corrispondenza allelica di più soggetti allo stesso tempo, per un determinato segmento di DNA. Il principio della tecnica è basato sull’osservazione di differenze nella distribuzione allelica tra i gruppi di individui affetti e non; e l’associazione allelica all’interno della stessa famiglia. L’identificazione dell’associazione del disturbo con un eventuale locus viene effettuata tramite un mix (pooling) di uguali quantità molari di DNA degli individui affetti e markers fluorescenti STR , utilizzando la PCR e la sequenza automatica del DNA. Le immagini del gel dei DNA amplificati, vengono analizzati da un software commerciale GENESCAN/GENOTYPER sul sistema ABI fluorescente. Il numero e la relativa frequenza degli alleli di ogni locus ottenuti viene comparata ad una banca di DNA di controllo che deriva dal mix di individui sani.

178

Figura 21: tecnica di DNA-pooling

La figura 21 mostra due esempi di questa tecnica, posti nella parte alta del riquadro, mentre in basso viene mostrata la verifica effettuata sui pazienti singolarmente. In questa metodica, il DNA dei probandi viene inserito nella stessa PCR utilizzando differenti primers compatibili tra loro; la successiva analisi dei risultati mostra la presenza degli alleli che vengono identificati nei “picchi” del nostro disegno: un solo picco corrisponde ad uno stato di omozigosi per lo stesso allele (uguale nei tre malati); più picchi indicano la presenza di differenti alleli anche se non ci danno informazioni circa la corrispondenza ai vari soggetti (come viene mostrato nella parte destra del disegno). Nel nostro caso, ricercando una condizione trasmessa con meccanismo autosomico recessivo, perché la manifestazione clinica della malattia avesse luogo, era necessario che il gene coinvolto si presentasse allo stato omozigote in tutti e tre i soggetti, quindi come un solo picco nelle nostre immagini. Per tale motivo solo le regioni presenti alla sinistra del riquadro sono stati presi in considerazione nel nostro studio. 3.7 ENZIMI DI RESTRIZIONE: RFLP (RESTRICTION FRAGMENT LENGTH POLYMORPHISM) Gli enzimi di restrizione sono endonucleasi di origine batterica che riconoscono e tagliano il DNA a doppia catena a livello di siti di riconoscimento ben definiti. I siti di riconoscimento sono costituiti generalmente da una sequenza di 4-6 paia di basi e l’enzima opera un taglio del legame fosfodiesterico su ambedue le eliche. La specificità del riconoscimento delle sequenze da parte dell’enzima può essere 179

utilizzata per l’identificazione di mutazioni. Infatti qualsiasi mutazione che alteri la composizione del sito di restrizione, impedirà il riconoscimento ed il taglio della sequenza stessa da parte dell’enzima. Il sito di restrizione può essere presente nel DNA nativo oppure venire creato appositamente durante l’amplificazione con un primer modificato (Restriction Generating-PCR). Questa modificazione della restrizione del DNA si mette facilmente in evidenza mediante gel-elettroforesi del DNA dopo digestione con l’endonucleasi specifica. Infatti i frammenti tagliati dall’enzima e i frammenti interi, nei quali non è stata riconosciuta la sequenza specifica, migreranno differentemente su una matrice di agarosio o di acrilamide avendo dimensioni differenti. In questo lavoro, dopo aver identificato la mutazione (tramite sequenziamento diretto) nei probandi, il DNA è stato sottoposto a digestione RFLP con un’endonucleasi specifica che riconosce la sequenza comprendente la mutazione. I prodotti della digestione sono poi stati separati su un gel di agarosio al 2% in 1X TBE buffer e visualizzati al transilluminatore. I frammenti ottenuti, paragonati a quelli degli altri membri della famiglia, e dei soggetti controllo, permettono di identificare in ogni individuo l’eventuale presenza della mutazione.

180

RISULTATI

4.0 DESCRIZIONE CASI CLINICI 4.01 Famiglia n. 1: Si tratta dei primi casi segnalati appartenenti ad un’ampia famiglia originaria della Calabria, dove siamo riusciti a risalire ai legami di parentela per cinque generazioni (Figura 22). Tre sono gli individui affetti, un maschio e due femmine, figli di cugini di primo o secondo grado, che presentano caratteristiche cliniche sovrapponibili con stessa modalità e tempistica di comparsa dei sintomi.

3

2

2

3

.0 15 6 2

.0 15 6 3 3

1

2

3

2

2

.0 62 5 2

2

2

33 Figura 22: albero genealogico famiglia n. 1

 Paziente n°2: Nato da genitori consanguinei (cugini di secondo grado); gravidanza e parto nella norma; due sorelle maggiori ed un fratello minore sani.

181

Madre operata per tumore mammario all’età di 35 anni. Familiarità per cardiopatie ed epatopatie. Eccetto che per un ritardo nella deambulazione autonoma (24 mesi), le acquisizioni psico-motorie sono avvenute nei tempi previsti per l’età cronologica. Verso i 3 anni di vita il bambino ha cominciato a presentare goffaggine motoria, disturbi di equilibrio, irrequietezza ed impulsività. All’età di 7 anni, momento della prima consultazione presso il nostro servizio, il quadro clinico appariva caratterizzato da: andatura atassica, tremori di azione e posturali degli arti, dismetria, disdiadococinesia, disartria cerebellare, tremori posturali del capo, e ipotonia ed atrofia muscolare. Vivaci apparivano i riflessi osteotendinei associati talora a clono della caviglia. Lo sviluppo cognitivo era normale con un QI ai limiti inferiori della norma (Wechsler Intelligence Scale for Children-Revised IQ, 77). Nel corso del follow-up, le condizioni neurologiche del paziente sono andate progressivamente aggravandosi: a 9 anni venivano registrate scosse miocloniche spontanee ed evocate degli arti superiori, e la comparsa di una ipoacusia neurosensoriale con evoluzione verso una sordità completa nell’arco di tempo di 4 anni. L’accrescimento somatico è risultato regolare fino ai 14 anni di vita, quando il ragazzo ha sviluppato un fenotipo clinico marfanoide, con facies allungata, alterato rapporto arti/corpo, e dita affusolate. Intorno ai 10 anni, inoltre, si è resa evidente una epatopatia cronica progressiva, con lieve innalzamento delle transaminasi glutammico-piruvica (GPT = 56 U/L; VR = 540), glutammico-ossalacetica (GOT=47 U/L; VR = 5-40) e della γ-glutamiltransferasi (γ-GT = 63 U/L; VR = 9-35), e immagini ecografiche che mostravano una irregolarità della superficie e una disomogeneità del parenchima epatico. Il ragazzo inoltre riferiva di soffrire di gastralgie.

182

Intorno ai 15 anni di vita si è manifestato un nistagmo binoculare ad alta frequenza, accompagnato da un maggior interessamento della componente dinamica della sindrome atassica con perdita dell’uso finalistico degli arti superiori. All’età di 17 anni infine, le condizioni del paziente si presentavano aggravate sia per un quadro neurologico caratterizzato da un pattern atassico-spastico tanto importante da non essere più compatibile con una deambulazione autonoma, da un incremento marcato del tremore del capo e dall’accentuarsi della disartria che rendeva il linguaggio non comprensibile; sia per la comparsa di una cardiomiopatia dilatativi ad evoluzione rapidamente progressiva che ha comportato il decesso in circa un anno. Una prima MRI effettuata all’età di 7 anni (Figura 23) mostrava un incremento diffuso e simmetrico del segnale della sostanza bianca nelle sequenze T2 pesate incluse le regioni sottocorticali (le fibre a “U”) e periventricolari, le fibre della capsula interna e del tratto corticospinale a livello del tronco encefalico, che, così come il corpo calloso, appariva anche assottigliato, e intorno ai trigoni e ai corni dei ventricoli laterali. Nel corso dei successivi controlli di radiodiagnostica si è evidenziato un interessamento anche della sostanza bianca sopratentoriale nella sequenze T2 pesate, e una ipointensità della sostanza bianca paratrigonale in quelle T1 (dai 14 anni di età).

Figura 23: MRI paziente n°2

183

Non sono mai stati riscontrati disturbi del visus e l’esame del fondo oculare risultava sempre nella norma, ciò nonostante, a partire dai 12 anni, i potenziali evocati visivi, sia i flash che i pattern reversal, apparivano alterati per un aumento della latenza della P2 e della P100 rispettivamente. I potenziali evocati troncoencefalici, invece, hanno evidenziato un incrementato della latenza di tutte le componenti, dalla I alla V onda, ad eccezione della prima via (a sinistra: 5.63 msec; a destra: 4.89 msec; normale: 4.7 m sec + 3 SDs). Dati anatomopatologici: Cardiomiopatia dilatativa biventricolare con ispessimento del miocardio sinistro. Encefalo normoconformato, di consistenza normale. Normale l’aspetto delle pachi e leptomeningi. Nelle sezioni coronali si è rilevato edema diffuso della sostanza nervosa con modica dilatazione dei ventricoli laterali. La sostanza bianca dei centri semiovali emisferici e cerebellare appariva ridotta in estensione e disseminata di piccoli focolai grigi, perlopiù sottocorticali, di consistenza non diversa dalla sostanza nervosa circostante né retratti nella superficie. Normale l’aspetto della corteccia degli emisferi. I nuclei della base, lenticolari e talami, presentavano irregolarità della colorazione per presenza di aree pallide disseminate tra aree di colorazione normale. Normale il midollo spinale. Il fegato presentava superficie esterna grossolanamente nodulare; incremento dello stroma fibroso; e numerosi noduli di colorito giallastro con marezzatura cianotica come tutto il resto del parenchima. Voluminoso nodulo sulla tibia sinistra. Soggetto leptoschelico con aracnodattilia.  Paziente n°3: Presentava un fenotipo clinico sovrapponibile al soggetto precedentemente descritto, salvo per la presenza di un ritardo cognitivo (QI: 58), associato ad un ritardo di linguaggio, evidenziato fin dalle prime fasi di sviluppo (dall’età di 2 anni), senza però un deterioramento mentale successivo; per una sindrome atassica più precoce (1 anno di vita) e grave sul piano delle autonomie

184

motorie, tanto da costringere la paziente su una sedia a rotelle all’età di 17 anni e mezzo; per una maggiore evidenza dei segni di interessamento piramidale; e per lo scarso interessamento epatico. Importante era, comunque, anche in questo caso, la ipoacusia neurosensoriale con evoluzione in sordità, come mostravano i potenziali evocati uditivi (Figura 24) effettuati in due diverse fasi dell’evoluzione clinica; la cardiomiopatia progressiva, restrittiva, con esito nel decesso, anche per questo paziente entro i 18 anni di vita; ed le immagini della risonanza magnetica (Figura 25), che oltre alle alterazioni della sostanza bianca cerebrale nelle sequenze in T1 e T2, evidenziavano anche una atrofia cerebellare.

Figura 24: BAEP paziente n°3 all’età di 9 e 14 anni

Figura 25: RMN paziente n°3

185

 Paziente n°1: Si tratta del soggetto più giovane, con una età attuale di 17 anni. Anche in questo caso l’esordio è precoce con un ritardo della deambulazione autonoma (18 mesi), associato ad un ritardo dello sviluppo del linguaggio (prime parole a 18 mesi, fino a 5 anni presenza di dislalie semplici). Intorno ai 3 anni di vita si manifestava sempre più chiaramente una sindrome atassica prevalentemente dinamica, a maggiore espressione distale, alla quale si associava, verso i 7 anni di vita, ipotono ed ipotrofia muscolare, ed una ipoacusia neurosensoriale (7 anni) con evoluzione in una sordità completa all’età di 12 anni. Parallelamente all’aggravarsi della sindrome atassica, anche per il presentarsi di una marcata disartria che rendeva incomprensibile il linguaggio (11 anni), a tremori di azione con componente mioclonica degli arti superiori, e dismetria (8 anni), si rendevano evidenti segni di un coinvolgimento del sistema piramidale (10 anni), una epatopatia cronica progressiva (10 anni), e frequenti gastralgie. Così come per il soggetto 2, intorno ai 13 anni, anche questa paziente ha cominciato a sviluppare un fenotipo marfanoide. All’età di 14 anni un controllo ecocardiografico ha evidenziato la comparsa di una lieve ipertrofia del setto interventricolare, che è degenerata in una cardiomiopatia dilatativa dopo 3 anni circa. La MRI mostrava una diffusa e simmetrica iperintensità della sostanza bianca nelle sequenze T2 pesate; mentre la spettroscopia evidenziava segni di danno neuronale con riduzione del NAA e un aumento del mioinositolo nella sostanza bianca (così come per il soggetto n°3), con concentrazione di NAA nella sostanza grigia normale (ridotta invece nel paziente n°3) e assenza del picco di lattato.

186

4.02 Famiglia n. 2: I soggetti affetti appartenenti a questa seconda famiglia (Figura 26) presentano un quadro clinico pressoché sovrapponibile ai casi precedenti, salvo forse una degenerazione più precoce del miocardio ed un deterioramento mentale.

5

5

4 5

6

7

Figura 26: albero genealogico famiglia n.2

 Paziente n°5: Genitori riferiti come consanguinei, anche se non è stato possibile risalire esattamente al grado di parentela. Nato a termine dopo una gestazione normale, ha presentato ricorrenti episodi di vomito, con ritardo della crescita ponderale (all’età di 9 anni 120 cromosomi), della stessa area geografica; c) proteina troncata o sostanziale modifica di un aminoacido importante in un dominio altamente conservato della proteina, o nel dominio funzionale; d) effetti sulla trascrizione del RNA messaggero o sulla sua stabilità o sito di splicing. In assenza di mutazioni riscontrabili a livello genomico, in alcuni casi è stata usata la RT-PCR, per ricercare mutazioni non convenzionali, quali: riarrangiamenti complessi, sequenze ripetute, o espansioni di sequenze. L’esempio del trascritto NP_940896, illustra l’approccio all’interpretazione dei risultati. Nei tre probandi (Famiglia n1), è stata identificata una mutazione puntiforme a livello dell’esone 6 allo stato omozigote, non riportata in letteratura (c.1477 G>A), che comporta una sostituzione di un aminoacido altamente conservato (Glu→Lys). Tramite l’utilizzo dell’enzima di restrizione MSE I (che consente di verificare la presenza della mutazione, sia allo stato di portatore eterozigote, che di affetto

193

omozigote) sono stati analizzati tutti i componenti della famiglia e, costruito l’aplotipo, si è potuto escludere questo gene poiché l’alterazione genomica non combaciava con la trasmissione della malattia. La mutazione si trovava, infatti, allo stato di omozigosi, non soltanto nei tre probandi, ma anche in un genitore, clinicamente sano. Un altro esempio, è stata la mutazione c.937 A>G (p.Asn>Asp) del gene ATPAF1, che è stata identificata nei tre pazienti, con una segregazione famigliare concordante, e senza riscontro in più di 200 alleli di controllo. In realtà, una variante simile è stata descritta come polimorfismo in linee cellulari tumorali, inoltre, ancora più importante, la proteina prodotta, un componente del complesso V della catena mitocondriale, era normalmente funzionante nel tessuto del paziente n 3. La figura 29 mostra i risultati dell’analisi elettroforetica Blue Native/SDS PAGE su muscolo del paziente n 3 che rileva un normale assemblaggio dei complessi della fosforilazione ossidativa, incluso il complesso V. Inoltre l’attività della ATP-sintetasi saggiata sui fibroblasti in cultura dei pazienti e di 5 controlli, non ha evidenziato nessuna differenza significativa. Questo ha portato alla esclusione del gene ATPAF1 come responsabile della ADCL.

Figura 29. Elettroforesi su gel di Blue native (BN-PAGE) del muscolo scheletrico del paziente n 3 (a sinistra) e in un controllo normale (a destra).

194

Durante lo studio dei risultati, non sono state riscontrate altre mutazioni patogene. Sono state rilevate, invece, numerose mutazioni puntiformi, sia allo stato eterozigote che omozigote. Si è proceduto, in questi casi, allo studio degli altri componenti sani e, qualora la trasmissione della mutazione corrispondesse all’analisi aplotipica della famiglia, sono stati esaminati anche pool di individui nella popolazione generale (con un minimo di 150 alleli), mediante l’utilizzo di enzimi di restrizione, al fine di individuare la percentuale di presenza della mutazione nella popolazione generale. Poiché si tratta infatti di una forma di leucodistrofia rara, una incidenza elevata avrebbe messo in dubbio che si trattasse della mutazione responsabile nel nostro caso. Lo studio degli SNP, inoltre, ci ha permesso di ridurre la regione ritenuta legata alla malattia da 7 a 3.11 Mb, contenente 69 geni, 25 dei quali altamente candidati poiché coinvolti in funzioni mitocondriali, proteine transmembrana o comunque di trasporto intracellulare, o ancora, importanti per lo sviluppo cerebrale. E’ stata infine individuata una mutazione puntiforme missence che comporta un cambio aminoacidico a livello di un gene posto nel cromosoma 1 (1p34). Si tratta di un gene non conosciuto e non legato ad altre patologie e che codifica per una proteina che dalla sequenza predice per un fattore di trascrizione. Vista la mancanza di informazioni relative alla funzione del gene e quindi all’implicazione eziopatogenetica che lo legava alla nostra malattia, lo studio di sequenza è continuato analizzando tutti i geni residui situati nella regione, al fine di escludere la presenza di altre mutazioni possibili. Sono stati infine analizzati gli individui affetti appartenenti alla seconda famiglia, i quali riportano una variante della stessa mutazione. Ciò ha consentito di confermare la rilevanza di questo gene nel determinare la malattia e la presenza della mutazione nella popolazione generale.

195

DISCUSSIONE

5.0 DEFINIZIONE CLINICA DELLA LEUCODISTROFIA INDIVIDUATA E DIAGNOSI DIFFERENZIALE Le caratteristiche cliniche riportate dai 7 pazienti presi in esame rappresentano un fenotipo unico, caratterizzato da una atassia ad esordio precoce lentamente progressiva, dalla successiva comparsa di una ipoacusia neurosensoriale con evoluzione in una sordità completa, e dallo sviluppo di una cardiomiopatia a rapida evoluzione che porta al decesso, associato ad alterazioni diffuse della sostanza bianca alla risonanza magnetica. Nella seconda famiglia a questi sintomi si associa un deterioramento cognitivo ed in 2 soggetti, anche un interessamento del sistema nervoso periferico. L’associazione tra atassia, sordità, cardiomiopatia e leucodistrofia è stata segnalata in letteratura solo in pochissimi casi. Nel 1970, Gullotta et al. descrivevano tre sorelle affette da un disturbo progressivo con esordio tra i 4 e gli 8 anni, caratterizzato da una perdita dell’udito in 2 soggetti, seguita da atassia, paraparesi spastica o ipotonica, con deficit peroneale bilaterale, disturbi del comportamento, e demenza. L’esame autoptico rivelò che la leucodistrofia sudanofila interessava soprattutto il cervelletto, la capsula interna, esterna ed estrema, suggerendo una variante ad esordio tardivo della malattia di Krabbe. Più numerosi sono i casi segnalati di associazione tra atassia e sordità all’interno di un quadro di degenerazione spinocerebellare. Jeune at al. riportano 2 sorelle di 8 e 11 anni, nate da matrimonio tra consanguinei, con una ipoacusia insorta verso i 6 anni che portava ad una sordità completa intorno agli 11. All’esordio appariva inoltre una

196

atassia cerebellare e un deterioramento mentale. Entrambe le sorelle mostravano alterazioni cutanee (macchie iperpigmentate su volto, braccia e gambe; lesioni tipo vitiligine sul dorso) e la maggiore, deceduta all’età di 12 anni, presentava al reperto autoptico, una sclerosi del miocardio, oltre ad un aspetto pallido della mielina cerebrale, alla degenerazione del tratto spinocerebellare e parzialmente anche del fascio posteriore. Ed ancora, Barman e Haslam hanno descritto una famiglia in cui tre maschi erano affetti da: atassia progressiva, ipoacusia, ritardo mentale, e segni di interessamento del motoneurone superiore ed inferiore. Recentemente, Nomoto et al. hanno descritto una nuova leucodistrofia a carattere familiare con paraparesi spastica, atassia, deterioramento mentale ed alterazioni scheletriche. Si tratta di una famiglia consanguinea giapponese con affetti in diverse generazioni, con una età compresa tra i 14 e i 56 anni. L’esordio è precoce, tra i 6 e gli 8 anni, con un disturbo della deambulazione lentamente progressivo. In un caso è stata segnalata sordità neurosensoriale, mentre in 2 su 5 pazienti erano presenti sintomi psichiatrici simili a quelli riscontrati nelle sindromi frontali. La MRI non evidenziava anomalie nelle fasi precoci, mentre successivamente mostrava una iperintensità della sostanza bianca cerebrale e cerebellare nelle sequenze T2 pesate; la spettroscopia, invece, indicava una riduzione del rapporto NAA/creatina ed un incremento del rapporto colina/creatina. Inoltre, all’interno delle leucodistrofie ben classificate, la sordità non viene segnalata come sintomo predominante; una associazione tra sordità neurosensoriale, atassia e leucodistrofia, come sintomi isolati o associati fra loro, sono invece comunemente riscontrati in un numero elevato di malattie mitocondriali. Anche se il pattern di ereditarietà, le caratteristiche ed il decorso clinico, l’attività biochimica normale della

197

catena respiratoria mitocondriale, in assenza di mutazioni del DNA mitocondriale, e l’assenza del picco di lattato rilevato in vivo alla spettroscopia, rendono difficile l’appartenenza a questo gruppo di malattie per i nostri casi.

5.1 CARATTERISTICHE DEL GENE Il cromosoma 1 rappresenta il più esteso cromosoma dell’organismo umano e costituisce fino all’8% del DNA totale contenendo all’incirca 263 milioni di paia basi. La regione p34, in particolare, costituisce una parte del cromosoma 1 di recente definizione in termini sia di sequenza genica sia di trascritti. Per dare una idea della complessità della regione e dei suoi trascritti basti pensare che sono circa 100 le patologie genetiche e le proteine codificate dalla regione p34.1-p34.3, che comprendono uno spettro di patologie che vanno dalla malattia di Alzheimer, al Parkinson, alla VWML fino alle alterazioni corneali, alla sordità, alla predisposizione alla dislessia, alla fucosidosi ed alla suscettibilità all’infarto del miocardio. Il gene ADCL (Figura 30) si trova sul braccio corto del cromosoma 1, si caratterizza per la presenza di 15 esoni, produce un trascritto di 3 kb e codifica per una proteina di 62,7 kDa consistente in 566 aminoacidi. 1

2

3

4

5

6

7

8

9

10

11

12

Trascritto

13

14

15

3099 bp

Proteina RING domain

566 aa

Figura 30

Dalle informazioni ricavate dall’ EST database, esistono quattro forme alternative di splicing del gene. Si sono riscontrate importanti analogie tra la regione amino-

198

terminale della proteina prodotta dal gene ADCL e i domini Zinc finger (Znf), in modo particolare con la variante RING-type. Questi domini Zinc finger sono piccoli motivi peptidici, contenenti uno o più atomi di zinco, che legano il DNA. Essi contengono molteplici protusioni a forma di dita (“finger”) che formano contatti di tipo tandem con la loro molecola target, svolgendo in questo modo un ruolo nella regolazione della trascrizione. La sequenza della proteina ACDL umana è relativamente conservata in: Bos taurus, Cavia porcellus, Echinops telfairi, Equus caballus, Felis catus, Gallus gallus, Macaca mulatta, Pan troglodytes, Rattus norvegicus e molto conservata in: Mus musculus and Canis familiaris. Mutazioni: La mutazione missence c. 1088G>A, rilevata allo stato di omozigosi nei tre probandi della famiglia n1, si trova nell’esone 8 e comporta un cambio aminoacidico importante: p.Arg363Gly. La segregazione della mutazione con il fenotipo clinico è confermata dal sequenziamento genomico diretto su tutti i componenti della famiglia, che si presentano allo stato di eterozigoti (portatori sani) o omozigoti per il wild-type (Figura 32). Inoltre la stessa mutazione non è stata rilevata in 150 copie alleliche nella popolazione di controllo.

Figura 32: Albero genealogico con indicazione dei soggetti malati (omozigoti per la mutazione c. 1088G>A), sani portatori (eterozigoti per la mutazione), e sani wild-type.

199

La seconda mutazione missence ritrovata allo stato di omozigosi negli individui affetti appartenenti alla seconda famiglia, c.1094G>A, si trova ad una tripletta di distanza dalla precedente, sempre nell’esone 8 e comporta lo stesso tipo di cambio aminoacidico: p.Arg365Gly. Anche per questa seconda mutazione si è proceduto all’analisi di oltre 150 alleli per escludere la presenza all’interno della popolazione generale. Entrambe le arginine sostituite, occupano residui amminoacidici altamente conservati nelle specie, presenti anche nel topo (Mus Musculus) e nel cane (Canis familiaris) (Figura 33).

human dog mouse

Mutazione R365Q Famiglia n 1

Mutazione R363Q Famiglia n 2 Figura 33

200

CONCLUSIONI 6.0

POSIZIONE

ALL’INTERNO

DELLA

DELLA

LEUCODISTROFIA

CLASSIFICAZIONE

INDIVIDUATA

GENERALE

DI

TALI

PATOLOGIE E SVILUPPI CLINICI FUTURI Lo studio della letteratura sulle leucoencefalopatie ha permesso l’ipotesi su cui si basa questo lavoro: definire la ADCL come nuovo fenotipo clinico di leucodistrofia. La rivisitazione nosografica, oltre ad escludere la presenza di casi segnalati paragonabili ai nostri pazienti, ha mostrato come le leucoencefalopatie o le leucodistrofie da causa non nota formino un gruppo eterogeneo di malattie, e come più del 60% dei bambini affetti da leucodistrofia restino non classificati nonostante estensive indagini diagnostiche. Per questo motivo, a nostro avviso, sarebbe importante cercare di caratterizzarli attraverso una combinazione di studi clinici (compreso l’utilizzo delle neuroimmagini), biochimici, anatomopatologici e genetici. Negli ultimi 10 anni, il gruppo americano di Schiffmann, in collaborazione con i più importanti centri europei che si occupano di leucodistrofie, ha raccolto un vasto numero di soggetti di tutte le età che presentavano segni clinici e radiologici di leucodistrofia, in assenza di una diagnosi eziologia nota, che sono stati sottoposti ad un ampio studio clinico e di laboratorio (figura 35) al fine di raggruppare questi pazienti all’interno di nuove forme clinico-patologiche e permettere così un successivo studio di linkage genetico. Attraverso tutte le indagini diagnostiche possibili, quindi, si cerca di creare gruppi di pazienti con caratteristiche simili, per poter non solo definire una nuova condizione clinica, ma soprattutto per l’identificazione del gene responsabile e per il riconoscimento del meccanismo eziopatologico di base. Ovviamente più elevato è il

201

numero di soggetti appartenenti al medesimo gruppo, maggiore è la percentuale di successo. Nel nostro caso è stato possibile individuare il gene responsabile grazie alla possibilità di effettuare uno studio di linkage genetico su una famiglia consanguinea molto informativa e di confermare la scoperta dato il successivo ritrovamento di altri 4 pazienti non correlati. Questo ha permesso di definire geneticamente una nuova malattia neurodegenerativa ad esordio precoce che colpisce vari organi in una sequenza temporale stabilita: prima l’encefalo, poi il fegato, e infine il cuore, con un meccanismo di trasmissione autosomico recessivo. OBIETTIVI 1. Definire gruppi omogenei 2. Trovare l’eziologia

CARATTERIZZAZIONE DEI PAZIENTI 1. Storia clinica e MRI cerebrale 2. Indagine diagnostica completa per escludere cause note 3. Spettroscopia e Diffusion tensor imaging, test cognitivi, potenziali evocati, EMG-NCV, ecc.

Studiare implicazioni del metabolismo

Studiare i tessuti di facile accesso

Biopsia cerebrale (se indicata) Analisi chimica, di struttura e genetica

Candidati all’analisi genetica

Analisi di linkage Analisi autoptica (quando possibile Gruppi omogenei Figura 35

Rimangono, a nostro avviso, aperte una serie di problematiche: a) Non esiste tuttora uno studio epidemiologico internazionale d’insieme che, da una parte, fornisca dati relativi alla prevalenza, incidenza e distribuzione

202

territoriale delle patologie leucodistrofiche e che, dall’altra, identifichi un referente unico che funga da recettore delle segnalazioni scientifiche. b) Agli avanzamenti in ambito diagnostico (studio proteomico o identificazione di markers biologico/biochimici di malattia che consentono di sorpassare le difficoltà tecnico-operative che sono intrinseche alla complessità dello studio genetico-molecolare) e terapeutico (trapianto di midollo osseo e transfezione genica tramite virus vettori o liposomi) che hanno segnato e stanno segnando gli ultimi anni della ricerca scientifica fa da contraltare la difformità di avanzamento scientifico delle diverse realtà nazionali. c) La letteratura medica è ricca di esempi di patologie leucodistrofiche relative a singoli casi o a ristrette aggregazioni familiari che, in alcuni casi, rappresentano degli unicum reali, in altri, potrebbero invece trovare corretta inclusione in specifiche entità o raggruppamenti sindromici. In assenza di un sistema operativo unico queste segnalazioni rimangono inevase dal punto di vista

diagnostico,

creando

non

poche

problematiche

e

ridondanze

classificatorie.

6.1

DIREZIONI

DELLA

RICERCA

VERSO

LA

DEFINIZIONE

DELL’ESPRESSIONE DEL GENE NEI VARI TESSUTI E LA SUA CARATTERIZZAZIONE FUNZIONALE Espressione del gene nei vari tessuti: Per studiare l’espressione del gene nei vari tessuti, è stata ricercata la distribuzione degli mRNA. Questi sono stati retrotrascritti mediante RT-PCR per ottenere il cDNA. Su questo cDNA è stata effettuata una PCR con primers specifici, per amplificare un frammento del trascritto della proteina ADCL di 250 bp, che ha mostrato come il trascritto del gene ADCL sia espresso in maniera ubiquitaria in vari tessuti: cervello,

203

fegato, cuore, rene, muscolo, midollo osseo, linfoblasti (Figura 31). Inoltre ha evidenziato una differente espressione a seconda dello stadio di sviluppo, infatti è rappresentato in misura ridotta nel fegato dell’adulto rispetto allo stadio fetale.

Figura 31

Analisi funzionale delle mutazioni: Per determinare l’effetto delle due mutazioni missenso sulla localizzazione subcellulare della proteina ADCL, cellule COS sono state trasfettate in maniera transiente con costrutti codificanti sia la proteina wild type, che le proteine mutanti, fuse alla loro estremità C-terminale con una coda myc. Per generare i costrutti, è stata eseguita una reazione di PCR, usando come templato cDNA di cervello umano (clonetech) e primer localizzati nelle regioni 3’ e 5’UTR, che ha prodotto un frammento di 2084 bp. Questo frammento è stato subclonato nel vettore pGMTeasy (Promega), è stata quindi eseguita una seconda PCR su questo costrutto con la coppia di

primer

5’gcttgcgtcgacTAATATTCCCTGCCCTGACC3’

e

5’ATCTAACGCCGGCGTCAAAGCAGGTCCTCCTCTGAGATCAGCTTCTGCATTGATGCCAAGTA GATCCTCCGCAGGTCTC3’,

contenenti siti di restrizione per gli enzimi SalI e NotI, e la

sequenza Myc-tag, necessari per la nostra strategia di clonaggio. Per introdurre le due mutazioni missenso, identificate in questo lavoro, è stata utilizzata una strategia di mutagenesi sito-diretta utilizzando primers contenenti la mutazione richiesta. 204

Successivamente, il frammento desiderato è stato clonato nel vettore d’espressione mammifero pCI-neo (Promega). I costrutti pCI-neo Myc tagged wild type e i due mutanti sono stati trasfettati in modo transiente in cellule COS-1 attraverso il kit Invitrogen Lipofectamine. A 24 ore dalla trasfezione, le cellule sono state lavatee con PBS e fissate in paraformaldeide al 4%, incubate con un anticorpo primario anti-myc ed un secondario goat-anti-rabbit marcato con alexa 680. Le immagini sono state raccolte ad un microscopio confocale Zeiss LSM 510 (Figura 34). Ciascun costrutto è stato trasfettato in duplicato. L’analisi di immunofluorescenza ha rivelato che la proteina ADCL wild type è localizzata elusivamente nel nucleo cellulare. L’immagine mostra fluorescenza nel nucleo, ma non nel nucleolo. In alcune delle cellule trasfettate sono stati osservati aggregati a livello del nucleo che potrebbero rappresentare un artefatto di trasfezione dovuto alla tossicità della sovraespressione. Lo stesso profilo di localizzazione è stato riscontrato per le due proteine mutanti (R363Q and R365Q), senza cambiamenti di localizzazione (Figura 34).

Anti-myc

Hoestch

pCI-neo empty Negative control

Wild-type

R363Q

R365Q

Figura 34

205

La presenza della proteina all’interno del nucleo cellulare, favorisce l’ipotesi iniziale di fattore di trascrizione. Si tratta inoltre di un gene dello sviluppo, come indicato dall’analisi dei trascritti nel fegato che mostra differenze tra lo stadio fetale e l’adulto. Come passo successivo nella comprensione della funzione del gene ADCL, comunque, è in corso lo studio di ibridazione in situ su fettine di cervello umano (sia adulto che fetale), e la transfezione di differenti frammenti nelle diverse cellule del sistema nervoso centrale (neuroni, oligodendrociti, astrociti).

Il lavoro attuale si concentra su due versanti principali: -

l’individuazione diagnostica di altri casi clinici sporadici o familiari, possibile tramite il riconoscimento di questa nuova forma clinica di leucodistrofia ADCL all’interno della nosografia internazionale,

-

l’ampliamento delle conoscenze sulla proteina ADCL al fine di poter comprendere l’eziopatogenesi della malattia ed ipotizzare così un eventuale protocollo terapeutico, se non di interruzione del processo patologico, quanto meno di un suo rallentamento.

206

BIBLIOGRAFIA •

Aicardi J : The inherited leukodystrophies: a clinical overview. J. Inher. Metab. Dis. 1993; 16, 733-743



Aicardi J : Disease of the nervous system in childhood. Chapter 9-10. 1998



Axelsson R, Röyttä M, Sourander P, Åkesson HO, Andersen O : Hereditary diffuse leukoencephalopathy with spheroids. Acta Psychiatr Scand 1984; 69 (suppl 314): 7-65



Baumann N, Pham-Dinh D : Biology of oligodendrocyte and myelin in the central nervous system. Physiol. Rev. 2001 ; 81, 871-927



Bezman L, Moser HW : Incidence of X-linked adrenoleukodystrophy and the relative frequency of its phenotype. Am. J. Med. Genet. 1998; 76, 415-419



Boespflug-Tanguy O, Mimault C, Melki J, Cavagna A, Giraud G, Pham-Dinh D, Dastugue B, Dautigny A : Genetic homogeneity of Pelizaeus-Merzbacher disease: tight linkage to the proteolipoprotein locus in 16 affected families. Am. J. Hum. Genet. 1994 ; 55, 461-467



Boucher SE, Cyper MA, Carlock LR, Skoff RP : Proteolipid protein gene modulates viability and phenotype of neurons. J. Neurosci. 2002 ; 22, 17721783



Boulloche J, Aicardi J : Pelizaeus-Merzbacher disease : clinical and nosological study. J. Child Neurol. 1986; 1, 233-239



Cailloux F, Gauthier-Barichard F, Mimault C, Isabelle V, Courtois V, Giraud G, Dastugue B, Boespflug-Tanguy O : Genotype-phenotype correlation in inherited difects of brain myelination due to proteolipid protein gene mutations. Eur. J. Hum. Genet. 2000; 8, 837-845

207



Di Biase A, Salvati S, Avellino C, Cappa M, Bertini E, Moroni I, Rimoldi M, Uziel G : X-linked adrenoleukodystrophy: first report of the Italian Study Group. Ital. J. Neurol. Sci. 1998; 19, 315-319



Fogli A, Rodriguez D, Eymard-Pierre E, Boespflug-Tanguy O : eIF2B and Cree Indian leukodystrophies. Med. Sci. 2003 ; 19, 283-284



Fogli A, Wong K, Eymard-Pierre E, Wenger J, Bouffard JP, Golden E, Black DN, Boespflug-Tanguy O, Schiffmann R : Cree leukoencephalopathy and CACH/VWM disease are allelic at eIF2B5 locus. Ann. Neurol. 2002 ; 52, 506510



Fogli A, Rodriguez D, Eymard-Pierre E, Bouhour RF, Labauge P, Meaney BF, Zeesman S, Kaneski CR, Schiffmann R, Boespflug-Tanguy O : Ovarian failure related to eukaryotic initation factor 2B mutations. Am. J. Hum. Genet. 2003; 72, 1544-1550



Fogli A, Dionisi-Vici C, Deodato F, Bartoli A, Boespflug-Tanguy O, Bertini E : A severe variant of CACH/VWM leukoencephalopathy related to eIF2B5 mutation. Neurology. 2002b; 59, 1966-1968



Francalaci P, Eymard-Pierre E, Dionisi-Vici C, Boldrini R, Piemonte F, Virgili F, Fardello G, Bosman C, Santorelli FM, Boespflug-Tanguy O, Bertini E : Fatal infantile leukodystrophy: a severe variant of CACH/VWM sindrome, allelic to chromosome 3q27. Neurology. 2001; 57, 265-270



Gordon N : Alexander disease (Review). Europ. J. Paed. Neurol. 2003; 7, 395-399



Goutieres F, Boulloche J, Bourgeois M, Aicardi J : Leukoencephalopathy, megaencephaly and mild clinical course. A recently individualized familial leucodystrophy. Report on five new cases. J. Child Neurol. 1996; 11, 436-444

208



Haataja L, Parkkola R, Sonninen P, Vanhanen SL, Schleutker J, Aarimaa T, Turpeinen U, Renlud M, Aula P : Phenotypic variation and magnetic resonance imaging (MRI) in Salla disease, a free sialic acid storage disorder. Neuropediatrics. 1994; 25, 238-244



Leegwater PA, Vermeulen G, Konst AA, Naidu S, Mulders J, Visser A, Kersbergen P, Mobach D, Fonds D, van Berkel CG, Lemmers RJ, Frants RR, Oudejans CB, Schutgens RB, Pronk JC, van der Knaap MS : Subunits of the translation initation factor eIF2B are mutant in leukoencephalopathy with vanishing white matter. Nat. Genet. 2001; 29, 383-388



Leuzzi V, Rinna A, Gallucci M, Di Capua M, Dionisi-Vici C, Longo M, Bertini E : Ataxia, deafness, leukodystrophy: Inherited disorder of the white matter in three related patients. Neurology 2000 ; 54, 2325-2328



Linnankivi T, Lundbom N, Autti T, Häkkinen AM, Koillinen H, Kuusi T, Lönqvist T, Sainio K, Valanne L, Äärimaa T, Pihko H : Five new cases of a recently described leukoencephalopathy with high brain lactate. Neurology. 2004 ; 63, 688-692



Mignot C, Boespflug-Tanguy O, Gelot A, Dautigny A, Pham-Dinh D, Rodriguez D : Alexander disease : putative mechanisms of an astrocytic encephalopathy. CMLS. 2004; 61, 369-385



Mimault C, Giraud G, Courtois V, Cailloux F, Boire JY, Dastugue B, Boespflug-Tanguy O and the clinical ENBDD : Proteolipoprotein gene analysis in 85 patients with sporadic Pelizaeus-Merzbacher disease: duplication, the major cause of the disease, but not point mutations originate more frequently in male germ cells. Am. J. Hum. Genet. 1999; 65, 360-369

209



Nomoto N, Iwasaki Y, Arasaki, Fujioka T, Kurihara T, Wakata N : Autosomal dominant childhood onset slowly progressive leucodystrophy- a Japanese family with spastic paraparesis, ataxia, mental deterioration, and skeletal abnormality. J. Neurol. Sciences. 2004; 221, 35-39



Pareek CS, Pareek RS, Walawski K : Novel linkage mapping approach using DNA pooling in human and animals genetics I. Detection of complex disease loci. J. Appl. Genet. 2002; 43 (2), 175-192



Saugier-Veber P, Munnich A, Bonneau D, Rozet JM, Lemerrer M, Gil R, Boespflug-Tanguy O : X-linked spastic paraplegia and Pelizaeus-Merzbacher disease are allelic disorders at proteolipoprotein locus. Nat. Genet. 1994; 6, 257-261



Seitelberger F: Neuropathological conditions related to neuroaxonal dystrophy. Acta Neuropathol 1971; suppl



Schiffmann R, Moller JR, Trapp BD, Shih HH, Farrer RG, Katz DA, Alger JR, Parker CC, Hauer PE, Kaneski CR, Quarles RD, Brady RO, Barton NW : Childhood ataxia with central nervous system hypomyelination. Ann. Neurol. 1994; 35, 331-340



Schiffmann R, van der Knaap MS : The latest on leukodystrophies. Curr. Opin. Neurol. 2004; 17, 187-192



van der Knaap MS, Barth PG, Gabreels FJ, Franzoni E, Begeer JH, Stroink H, Rotteveel JJ, Valk J : A new leukoencephalopathy with vanishing white matter. Neurology 1997; 48, 845-855



van der Knaap MS, Naidu S, pouwels PJ, Bonavita S, van Coster R, Lagae L, Sperner J, Surtees R, Schiffmann R, Valk J : New syndrome characterized by

210

hypomyelination with atrophy of the basal ganglia and cerebellum. Am. J. Neuroradiol. 2002; 23, 1466-1474 •

van der Knaap MS, Naidu S, Kleinschmidt-DeMasters B, Kamphorst W, Weinstein H: Autosomal dominant diffuse leukoencephalopathy with neuroaxonal spheroids. Neurology. 2000; 54 (2), 463-470



van der Knaap MS, Wevwrs RA, Struy EA, Verhoeven NM, Pouwels PJW, Engelke UFH, Feikema W, Valk J, Jakobs C: Leukoencephatopathy associated with a disturbance in the metabolism of polyols. Ann Neurol. 1999; 46: 925928



Verheijen FW, Verbeek E, Aula N, Beerens CE, Havalaar AC, Joosse M, Peltonen L, Aula P, Galjaard H, van der Spek PJ, Mancini GM : A new gene, encoding an anion transporter, is mutated in sialic acid storage disorder. Nat. Genet. 1999; 23, 426-465



Wolf NI, Willemsen MAAP, Engelke UF, van der Knaap MS, Pouwels PJW, Harting I, Zschocke J, Sistermans EA, Rating D, Wevers RA: Severe hypomyelination associated with increased levels of N-acetylaspartylglutamate in CSF. Neurology. 2004; 62 (9), 1503-1508



Wong K, Armstrong RC, Gyure KA, Morrison AL, Rodriguez D, Matalon R, Johnson AB, Wollmann R, Gilbert E, Le BS TQ, Bradley CA, Crutchfield K, Schiffmann R : Foamy cells with oligodendroglial phenotype in childhood ataxia with diffuse central nervous system hypomielination syndrome. Acta Neuropathol. (Berl.) 2000; 100, 635-646

211

View more...

Comments

Copyright © 2017 DOCUMEN Inc.