Tesi Montieri 2009 - ART - TORVERGATA OA

April 8, 2018 | Author: Anonymous | Category: Scienza, Biologia, Biochimica, Genetica
Share Embed


Short Description

Download Tesi Montieri 2009 - ART - TORVERGATA OA...

Description

UNIVERSITÀ DEGLI STUDI DI ROMA "TOR VERGATA" FACOLTA' DI MEDICINA DIPARTIMENTO DI NEUROSCIENZE SETTORE SCIENTIFICO-DISCIPLINARE MED/20

DOTTORATO DI RICERCA IN NEUROSCIENZE

CICLO DEL CORSO DI DOTTORATO XXI

Titolo della tesi STUDIO CLINICO E GENETICO-MOLECOLARE IN PARAPARESI SPASTICHE EREDITARIE AD ESORDIO PRECOCE

Pasqua Montieri

A.A. 2009/2010 Docente Guida/Tutor: Prof. Antonio Orlacchio Coordinatore: Prof. Giorgio Bernardi

 

"La leggerezza...si associa con la precisione e la determinazione, non con la vaghezza e l'abbandono al caso" Italo Calvino (Lezioni americane)



ABSTRACT Le paraparesi spastiche ereditarie (HSPs) rappresentano un gruppo eterogeneo di disturbi neurologici con interessamento del motoneurone superiore (UMND) la cui caratteristica clinica prevalente è la spasticità e l’ipostenia piramidale degli arti inferiori. HSP può essere classificata clinicamente in accordo alla modalità di ereditarietà, età di insorgenza o il fenotipo clinico. Questo disturbo è ereditato più spesso secondo la modalità autosomica dominante, meno frequentemente con ereditarietà autosomica recessiva e raramente secondo modalità di trasmissione X-linked. Pochi studi epidemiologici sono stati condotti sulle HSPs, ma la prevalenza è stimata tra 3-10:100 000, di cui le forme di HSP ad ereditarietà autosomica dominante costituiscono circa l’80% dei casi nei paesi Occidentali (con le forme più comuni in SPG4 e SPG3A). A dispetto di una eterogeneità genetica con 46 loci genetici (di cui 5 riservati) e 20 geni identificati, è più difficile separare le diverse entità nosografiche sul piano clinico. Questa uniformità fenotipica forse riflette un pathway finale comune nei processi della malattia da cui esita una degenerazione retrograda assonale dei tratti cortico-spinali e delle colonne posteriori. Studi recenti hanno permesso di identificare i geni di circa la metà di questi loci, suggerendo un’interruzione a più livelli come possibile causa di danno assonale: nel trasporto assonale e nella regolazione citoscheletrica, nelle funzioni mitocondriali, nel mantenimento e assemblaggio della mielina e nella migrazione neuronale. Questo studio ha l’obiettivo di effettuare un’indagine genetico-molecolare di famiglie affette da forme ad esordio precoce di ADHSP, ARHSP e casi apparentemente sporadici, sia con fenotipo clinico “non complicato” che “complicato”. Uno studio di linkage a 2 punti è stato effettuato in una famiglia ADHSP per 8 loci noti autosomico dominanti (SPG3A, SPG4, SPG6, SPG8, SPG10, SPG12, SPG13, SPG31). I risultati indicano che il disturbo in questa famiglia era legato al locus noto SPG3A. Attraverso il sequenziamento diretto degli esoni codificanti e delle regioni fiancheggianti gli introni del gene SPG3A è stata individuata una nuova mutazione missenso nell’esone 12 al nucleotide c.1246 C>T (p.R416C). La Arginina 416 è altamente conservata tra le specie. Ho analizzato i 3 geni HSP ad esordio precoce, SPG3A, SPG5A and SPG42, attraverso l’analisi di sequenziamento diretto nel restante campione composto dai probandi di 9 famiglie non imparentate autosomico dominanti, 3 autosomico recessive e 18 pazienti con paraplegia spastica apparentemente sporadica, con forme pure e complesse di malattia.



L’analisi MLPA effettuata nei pazienti candidati per SPG3A (kit P165-HSP-B1, MRCHolland) non ha individuato nessun cambiamento patogenetico. Attraverso il sequenziamento diretto ho evidenziato cinque mutazioni, di cui tre nuove, una che segrega in due famiglie non imparentate e le altre in casi apparentemente sporadici. Quattro di queste mutazioni sono missenso: c.1246 C>T (p.R416C) e c.1243 C>T (p.R415W) nel gene SPG3A, c.995 T>C (p.F264S) e c.344C>T (p.S115F) nel gene SPG5A. Una è un’inserzione che esita in un frameshift con l’introduzione di uno stop prematuro al codone Cterminale della proteina: c.1362insT (p.A453CfsX470) nel gene SPG5A. Nessun cambio patogenetico è stato individuato nel gene SPG42. È interessante che sia l’esordio precoce sia possibili fenomeni di anticipazione genetica siano stati osservati nelle due famiglie che presentano la mutazione p.R416C in ATL1. Questi risultati confermano i dati osservati in letteratura per cui i geni SPG3A e SPG5A mostrano un’alta frequenza mutazionale nelle forme ad esordio precoce di ADHSP e ARHSP (rispettivamente il 20 e il 7%) e nei casi apparentemente sporadici.



ABSTRACT The hereditary spastic paraplegias (HSPs) are an etiologically heterogeneous group of neurological disorders which results from the selective degeneration of upper motor neurons (UMNs), of which key diagnostic clinical findings are spasticity and pyramidal weakness of lower limbs. HSP can be classified clinically according to mode of inheritance, age of onset or clinical phenotype. The disorder is inherited most often as an autosomal dominant trait, with autosomal recessive and X-linked inheritance occurring rarely and very rarely, respectively. Few epidemiological studies of HSP have been done, but prevalence is estimated at 3–10 cases per 100 000 population in western countries, in which approximately ADHSPs account for 80% of all HSPs (with SPG4 and SPG3A being the most common forms). Although genetically diverse with 46 genetic loci for HSP (of which 5 reserved) and 20 genes identified, it is often difficult to separate the disorders on clinical grounds. This phenotypic uniformity perhaps reflects a final common pathway in the disease process which results in degeneration of the corticospinal tracts and posterior columnes. Advances in recent years identifying the genes at half of these loci have suggested that disruption in any of the following: axonal transport, cytoskeleton regulation, mitochondrial function, myelin maintenance and assembly and neuronal migration may cause axonal damage in HSP. This study aims at genetic-molecular investigation of families affected by early onset forms of ADHSP, ARHSP, and apparently sporadic cases, as with “uncomplicated” or “complicated” clinical phenotype. Two point linkage analyses were performed in a ADHSP family to 8 known autosomal dominant loci (SPG3A, SPG4, SPG6, SPG8, SPG10, SPG12, SPG13, SPG31). The data indicated that the disorder in this kindred was linked to the known HSP locus SPG3A. Sequencing the SPG3A gene coding exons and flanking intronic regions disclosed a novel heterozygous missense mutation in exon 12 at nucleotide c.1246 C>T (p.Arg416Cys). The Arginine 416 is highly conserved among species. I analysed the coding region and exon–intron boundaries of 3 “early onset” HSP genes, SPG3A, SPG5A and SPG42, by direct sequencing in a total serie of 9 unrelated autosomal dominant and 3 autosomal recessive hereditary spastic paraplegia index patients, and in 18 unrelated index patients with apparently sporadic hereditary spastic paraplegia, manifesting either pure or complex forms of the disease. Multiplex ligation-dependent probe amplification performed in SPG3A candidate patients 5 

(probe mixtures P165-HSP-B1, MRC-Holland, The Netherlands) did not detect any pathogenic changes. By direct sequencing I identified five, including three novel, mutations, one segregating in two unrelated families, the others in apparently sporadic cases. Four of these mutations were missense: c.1246 C>T (p.R416C) and c.1243 C>T (p.R415W) in SPG3A gene, c. 995 T>C (p.F264S) and c.344C>T (p.S115F) in SPG5A gene. One resulted in a frameshift with the introduction of a premature stop codon at the C-terminal of the protein: c.1362insT (p.A453CfsX470) in SPG5A gene. Any pathogenic changes was detected in SPG42 gene. Interestingly, both early-age onset and possible anticipatory phenomena were observed in the two families showing mutation p.R416C in ATL1. These results confirm data observed in literature according to which the SPG3A and SPG5A genes show an high mutational frequency in early onset forms of ADHSP and ARHSP (respectively 20% and 7%) and apparently sporadic cases.  



INDICE

Abstract

Pag 3

1 – PARAPARESI SPASTICHE EREDITARIE (HSPs) 1.1 Classificazione

Pag 9

1.2 Epidemiologia

Pag 16

1.3 Aspetti clinici

Pag 19

1.3.1

I principali fenotipi SPG

1.3.2

Diagnosi differenziale

1.3.3

Studi in vivo e ex vivo

1.3.4

Scala di valutazione funzionale (SPRS)

1.4 Ipotesi sui meccanismi etiopatogenetici 1.4.1

Trasporto assonale e traffico di membrana

1.4.2

Funzioni mitocondriali

1.4.3 1.4.4

Mantenimento e assemblaggio della mielina e migrazione neuronale Altri meccanismi etiopatogenetici

1.4.5

Modelli animali

1.5 Forme ad esordio precoce per i geni analizzati 1.5.1

SPG3A

1.5.2

SPG5A

1.5.3

SPG42

2 - OBIETTIVI

Pag 60

Pag 82

Pag 88

3 - MATERIALI E METODI 3.1 Pazienti 7 

Pag 91

3.2 Tecniche di laboratorio 3.2.1

Sequenziamento diretto DNA

3.2.2

Linkage

3.2.3

MLPA

3.3 Analisi dei dati

Pag 93

Pag 109

4 - RISULTATI 4.1 Analisi del gene SPG3A

Pag 111

4.2 Analisi del gene SPG5A

Pag 116

4.3 Analisi del gene SPG42

Pag 120

5 - DISCUSSIONE E CONCLUSIONI

Pag 121

6 - BIBLIOGRAFIA

Pag 124

7 - APPENDICI

Pag 140

7.1

Protocolli clinici

7.2

Protocolli di laboratorio

       



Capitolo1 – PARAPARESI SPASTICHE EREDITARIE (HSPs) 1.1

Classificazione

Le paraparesi spastiche ereditarie (HSPs) sono disturbi mono-genici in cui gli assoni del tratto cortico-spinale o fallisce lo sviluppo normale o va incontro a una progressiva degenerazione. Sono stati descritti modelli di ereditarietà autosomica dominante (ADHSP), autosomica recessiva (ARHSP), e X-linked recessiva nelle HSPs. ADHSPs sono più spesso “pure” in termini clinici, mentre le ARHSPs sembrano essere più complesse e associate con un’età di esordio più precoce. Ad oggi sono stati identificati circa la metà dei geni causativi, sono state osservate alcune sovrapposizioni nelle presentazioni cliniche, e una nuova classificazione sta ora emergendo dai dati molecolari e clinici. La principale caratteristica clinica di tutte le HSPs è una paraparesi spastica bilaterale, simmetrica, lentamente progressiva. Clinicamente la maggior parte dei pazienti ha le stesse caratteristiche principali, che includono andatura spastica, ipertonia dell’arto inferiore, risposta plantare in estensione, e ipostenia muscolare, e qualche volta questi si associano a diminuite pallestesie alle estremità distali, disfunzione vesicale, piede cavo o scoliosi. Quando questi segni sono le uniche caratteristiche cliniche, la malattia è descritta come “pura” o “non complicata”. Le forme “complicate” o “complesse” hanno segni o sintomi neurologici ed extraneurologici aggiuntivi, che comprendono ritardo mentale, atassia cerebellare, epilessia, neuropatia periferica, atrofia muscolare, atrofia ottica, retinite pigmentosa, sordità, ittiosi, cataratta. A.E. Harding nel 1981 e in un successivo lavoro del 1983 ipotizza una classificazione in base alla presentazione clinica in forme di HSP pura o non, e in base all’età di esordio (con un cut-off intorno ai 35 anni di età). Secondo la classificazione proposta da Harding la paraplegia spastica ereditaria pura (HSP) (Strümpell disease) implica la presenza di segni piramidali negli arti inferiori ma non esclude casi con riflessi tendinei aumentati, lieve danno dei movimenti rapidi alternanti, o amiotrofia distale lieve negli arti superiori. I nervi cranici e il linguaggio non sono interessati. Le HSP autosomiche dominanti comprendono sia forme ad esordio precoce che tardivo. Nei casi ad esordio precoce (prima dei 35 anni) è comune un ritardo motorio e la spasticità degli arti inferiori è più marcata dell’ipostenia; la disabilità è lentamente progressiva e molto variabile. Nel caso dell’esordio è tardivo (di solito sopra i 35 anni), l’ipostenia muscolare può esser marcata e i sintomi urinari sono frequenti, con una evoluzione più rapida. 9 

Tutte le forme complicate di HSP sono indicate da Harding come rare. Negli anni successivi numerosi studi hanno dimostrato che questa classica divisione delle HSPs in forme pure e complesse, ancora in uso nella pratica clinica, è imperfetta e richiede chiarificazioni attraverso migliori correlazioni fenotipo-genotipo. La scoperta di geni che sottendono geneticamente specifici sottotipi di HSP e la progressiva definizione dei fenotipi associati ha portato ad una rinnovata nosologia. La paraplegia spastica ereditaria può essere classificata in base - al locus HSP quando noto: sono stati assegnati i loci SPG da 1 a 46 seguendo l’ordine della

loro

scoperta

http://www.genenames.org,

(database OMIM

HUGO Online

Gene

Nomenclature

Mendelian

Inheritance

Committee, in

Man,

http://www.ncbi.nlm.nih.gov/omim ), - secondo la modalità di ereditarietà: autosomica dominante, autosomica recessiva, e Xlinked, - secondo il fenotipo: HSP “non complicata” se la sindrome paraplegia spastica ricorre prevalentemente da sola, “HSP complicata” se presenta anomalie aggiuntive neurologiche o sistemiche. In questa tesi ho scelto di classificare le HSPs secondo la numerazione progressiva dei diversi loci per le paraplegia spastiche (SPG) e di dividerle in quattro gruppi. Seguendo gli obiettivi di questo lavoro di tesi ho posto particolare attenzione all’età di esordio (AO= age of onset), stabilendo un cut-off intorno ai 20 anni: - il primo gruppo (Tabella 1.1a) indica le forme di HSPs i cui i geni causativi sono stati identificati, in questo gruppo includo forme con un esordio esclusivamente precoce, e forme con un range di AO anche precoce, specificando per ciascuna forma l’età di esordio; - il secondo gruppo (Tabella 1.1b) indica le forme di HSPs i cui i geni causativi sono stati identificati con un esordio prevalentemente o esclusivamente tardivo; - il terzo gruppo (Tabella 1.2a) indica i loci mendeliani HSPs, per i quali le cause genetiche che sottendono non sono ancora note, in questo gruppo includo forme con un esordio esclusivamente precoce, e forme con un range di AO anche precoce; - il quarto gruppo (Tabella 1.2b) indica i loci mendeliani HSPs, per i quali le cause genetiche che sottendono non sono ancora note, con un esordio prevalentemente o esclusivamente tardivo.

10 

Tabella 1.1a. SPG secondo i geni causativi di HSP con “esordio precoce”*. Loci genetici/ Cromosoma SPG1/Xq28

SPG2/Xq22 SPG3A/14q12q21

SPG5A/8q21.3

SPG6/15q11.2q12

SPG10/12q13

Gene/ Proteina

Ereditarietà

L1CAM/ L1 molecola di adesione cellulare

X-linked

Età di esordio (AO) Prima infanzia

PLP1/ Proteolipoproteina 1 ATL1/ Atlastina

X-linked

Prima infanzia

AD

Esordio precoce, prima dei 10 anni

CYP7B1/ Citocromo P450, famiglia 7, sottofamiglia B, polipeptide 1 NIPA1/ Proteina 1 non imprinted nella regione della sindrome di Prader-Willi KIF5A/ membro 5A della famiglia delle kinesine

AR

Esordio variabile (preval. adolescenti e giovani adulti)

HSP pura (preval.) e complicata (segni cerebellari dopo lunga durata di malattia)

AD

Esordio in adolescenza preval. (8-35 anni)

HSP pura

AD

Esordio variabile (preval. adolescenti e giovani adulti) (2-51 anni)

HSP pura e complicata, con neuropatia periferica, grave amiotrofia degli arti superiori (tipo Silver syndrome), deterioramento mentale, parkinsonismo, sordità e/o retinite pigmentosa assottigliamento del corpo calloso (HSP-TCC), deterioraramento cognitivo e neuropatia

SPG11/15q21.1

SPG11/KIAA1840/ Spatacsina

AR

Esordio variabile (dall’infanzia alla giovane età adulta) (1-27 anni)

SPG15/14q24.1

ZFYVE26/ Spastizina

AR

Esordio in adolescenza preval. (13-23 anni)

SPG17/11q12-q14

BSCL2/ Seipina

AD

SPG20/13q12.3

SPG20/ Spartina

AR

Esordio variabile (dall’infanzia alla giovane età adulta) Esordio in infanzia

SPG22/Xq13.2

SLC16A2/ Solute carrier family16, member 2

X-linked

11 

Prima infanzia

Caratteristiche cliniche associate Sindrome MASA (ritardo mentale, afasia, andatura spastica, pollice addotto), Sindrome CRASH (ipoplasia del corpo calloso, ritardo mentale, pollice addotto, paraplegia spastica e idrocefalo X-linked ) HSP pura e complicata, con ritardo mentale e crisi epilettiche HSP pura (preval.) e complicata (neuropatia assonale motoria e/o sensitiva)

Sindrome di Kjellin, retinopatia pigmentosa, segni cerebellari, ritardo mentale, assottigliamento del corpo calloso (HSPTCC) Sindrome di Silver, amiotrofia distale degli arti superiori>arti inferiori Sindrome di Troyer, alta frequenza nella popolazione Old Order Amish, disartria, amiotrofia distale, ritardo mentale lieve, bassa statura Sindrome di AllanHerndon-Dudley, ritardo mentale, ipotonia e atrofia muscolare, dimorfismi facciali

Riferimento 2006 BaselVanagaite, 1994 Jouet

2009 Hassen, 1994 SaugierVeber 2009 Salameh, 2009 Fusco, 2009 Svenstrup, 2009 Smith, 2009 de Leva, 2008 Haberlova 2009 Goizet, 2009 Criscuolo, 2009 Biancheri, 2008 Tsaousidou, 2007 Klebe 2009 Grzmil, 2006 Kaneko, 2005 Reed, 2003 Rainier, 1995 Fink 2009 Goizet, 2002 Reid

2009 Crimella, 2009 Anheim, 2008 Samaranch, 2008 Erichsen, 2008 Boukris, 2008 Stevanin 2009 Goizet, 2009 Denora, 2008 Hanein, 2007 Elleuch 2009 Brugman, 2009 Ito, 2008 Cafforio, 2007 Silver 2009 Milewska, 2007 Bakowska, 2002 Patel 2004 Bohan e Azizi

SPG31/2p12

REEP1/ Receptor expressionenhancing protein 1

AD

SPG39/19p13

PNPLA6/ Neuropathy target esterase SLC33A1/ AcetylCoA trasporter

AR

SPG42/3q25.31

SPG44/1q42.13

GJA12/GJC2/ Connessina 47

AD

AR

Prima e seconda decade nella maggior parte dei casi (distribuzione bimodale) Esordio in infanzia (2 famiglie note) Esordio variabile (prima e seconda decade preval.) (1 famiglia nota) Prima e seconda decade (1 famiglia nota)

HSP pura

2009 Liu, 2008 Beetz, 2008 Schlang, 2006 Zuchner

Marcata ipotrofia distale degli arti superiori e inferiori HSP pura

2008 Rainier

Disartria, atassia cerebellare e crisi epilettiche

2008 Lin

2009 OrthmannMurphy

* forme di HSP con un esordio esclusivamente precoce, e forme con un ampio range di AO anche in età pediatrica, specificando per ciascuna l’età di esordio;

12 

Tabella 1.1b. SPG secondo i geni causativi di HSP con “esordio tardivo”. Loci genetici/ Cromosoma SPG4/2p22

Gene/ Proteina

Ereditarietà

SPAST/ Spastina

SPG7/16q24.3

SPG8/8q24 SPG13/2q24-q34 SPG21/15q21-q22

13 

AD

Età di esordio (AO) Esordio variabile

Caratteristiche cliniche associate HSP pura (preval.)

SPG7/ Paraplegina

AR

Esordio variabile

KIAA0196/ Strumpellina HSPD1/ HSP60/ Heat shock protein 60 SPG21/ Maspardina

AD

In età adulta (G hanno sviluppato una forma di HSP, caratterizzata da un progressivo disturbo dell’andatura dalla prima alla quarta decade, due pazienti con esordio nella prima decade e uno con esordio nella seconda decade di vita. Il probando presenta una paraplegia spastica quasi pura con lieve atassia e disartria e deambulazione autonoma fino all’età di 39 anni. Suo fratello presenta una paraplegia spastica moderatamente complicata, con lieve atassia e disartria, qualche crisi e deambulazione con supporto laterale fino a 36 anni. Il cugino ha un fenotipo complesso più grave, con esordio più precoce e necessità della sedia a rotelle all’età di 30 anni. Questi pazienti sono distinguibili dal più grave fenotipo PMDL causato da altre mutazioni recessive nello stesso gene GJA12/GJC2 per l’esordio più tardivo, la capacità di deambulazione autonoma fino all’età adulta e l’assenza di nistagmo. I pazienti descritti nello studio di Orthmann-Murphy et al. (2008) presentano una paraplegia spastica lentamente progressiva, con atassia e disartria da lieve a moderate, e crisi epilettiche, suggerendo che si tratti di un fenotipo complicato di HSP. Come per PLP1, le mutazioni in GJA12/GJC2 sembrano causare uno spettro di malattia della sostanza bianca del SNC che include HSP e PMD/PMDL. ARHSPs “late onset” di cui sono noti i geni: SPG7 (Paraplegina). Mutazioni nel gene SPG7 che codifica per la paraplegina, costituiscono circa il 5% delle mutazioni patogenetiche di ARHSP. La forma SPG7 era inizialmente stata descritta come una forma pura di malattia, in seguito è stata osservata sia come fenotipo puro che complicato da atrofia cerebellare e vari gradi di disfunzioni cerebellari (disartria, nistagmo, atassia), pallore della papilla ottica, e neuropatia periferica e deficit mentali (Warnecke et al., 2007; Arnoldi et al., 2008). Un ampio numero di polimorfismi missenso, che sono spesso stati trovati in stato eterozigote, complicano grandemente l’analisi genetica (Elleuch et al., 2006). Se essi siano polimorfismi neutri, fattori di suscettibilità o varianti causative rimane da determinarsi. La variante p.A510V, comunque sembra alteri la funzione della proteina SPG7 (Di Bella et al.,

34 

2007), in accordo con la sua frequente associazione con mutazioni in eterozigosi (Arnoldi et al., 2008). Nella maggior parte dei casi le mutazioni interessano importanti domini funzionali. In tutti eccetto un caso, gli individui affetti sono o omozigoti per mutazioni in paraplegina o sono eterozigoti compositi con due differenti mutazioni su ciascun allele. Un’eccezione è stata descritta in una famiglia Inglese in cui il probando è un eterozigote composito (ERR4846del/A510V), mentre il padre del probando presenta solo la delezione ed è clinicamente affetto (Mc Dermott et al., 2001). Gli autori ipotizzano che SPG7 possa essere ereditata anche come un tratto autosomico dominante. In tutte le altre famiglie pubblicate l’editarietà è chiaramente autosomica recessiva o sporadica. SPG21 (ACP33). La Mast syndrome è una forma complicata di HSP associata al locus SPG21 (Cross e McKusick., 1967) nei membri della Old Older Amish (come SPG20), in cui l’esordio di malattia è di solito durante l’infanzia (Simpson et al., 2003). Una singola mutazione (c.601insA) è stata descritta nel gene della proteina ACP33 (acid-cluster protein) di 33 kDa. L’inserzione nucleotidica determina un frameshift e uno stop prematuro, da cui la patogenesi è probabilmente legata ad una perdita di funzione della proteina maspardina (Mast Syndrome, Paraplegia spastica, Autosomica Recessiva con Demenza). La Mast syndrome si associa a demenza, segni cerebellari ed extrapiramidali, e assottigliamento del corpo calloso (HSP-TCC). Molti pazienti mostrano un funzionamento relativamente normale in età giovanile prima di sviluppare importanti difficoltà motorie e cognitive. In casi avanzati è stata descritta rigidità alle gambe e i pazienti diventavano poi allettati. Sono stati osservati riflessi primitivi e movimenti extrapiramidali. Le neuroimmagini in alcuni pazienti hanno dimostrato un assottigliamento del corpo calloso, atrofia generalizzata e alterazioni di segnale della sostanza bianca in accordo con la demielinizzazione. La maspardina sembra localizzarsi alle vescicole della rete endosomiale/trans-Golgi, facendo ipotizzare un ruolo nel trasporto della proteina e nello smistamento (Zeitlmann et al., 2001). ARHSPs “early onset” di cui sono noti solo i loci: SPG18 (RISERVATO).

35 

Al-Yahyaee e coll. (2006) hanno descritto due famiglie consanguinee non imparentate tra loro dell’Oman con una forma di SPG autosomica recessiva complicata. Nella prima famiglia l’età d’esordio è nei primi 2 anni di vita in 6 soggetti affetti, tutti con spasticità agli arti inferiori e ipostenia, ipereflessia, e risposte plantari in estensione. Tre presentano una spasticità lieve agli arti superiori. Tutti e 6 presentano ritardo mentale, e in 5 si riscontra ipoplasia o agenesia del corpo calloso (HSP-TCC). Nella seconda famiglia i 3 individui affetti hanno presentato difficoltà alla deambulazione tra i 4 e i 6 anni di vita, all’esame neurologico si rileva spasticità agli arti inferiori soprattutto ai muscoli della loggia posteriore e i tibiali posteriori, due dei bambini presentano epilessia. Tutti hanno referti normali alla TC cerebrale e uno sviluppo cognitivo normale. Attraverso analisi di linkage dell’intero genoma, gli autori hanno identificato per entrambe le due famiglie un locus candidato di malattia, indicato come autosomico recessivo e localizzato sul cromosoma 8p12-p11.21. Nel database OMIM la forma SPG18 è in accordo con il lavoro di Al-Yahyaee e coll. (2006). Nel database HUGO (HGNC:18009), SPG18 è indicato come autosomico dominante e “riservato”. SPG23. Una famiglia Araba con paraparesi spastica complicata da anomalie della pigmentazione di pelle e capelli e danno cognitivo lieve è stata associata al locus SPG23 (Blumen et al., 2003). Altre famiglie sono state descritte con un fenotipo simile con neuropatia assonale che potrebbe anche essere associata con questo locus (Abdallat et al., 1980; Lison et al., 1981; Bamforth, 2003). Alle anomalie pigmentarie cutanee possono aggiungersi dimorfismi facciali e scheletrici, declino cognitivo, tremore. Le caratteristiche peculiari di SPG23, anche detta Sindrome di Lison, sono le anomalie del pigmento, rappresentate da vitiligine a chiazze, aree di pelle iperpigmentata, efelidi e prematuro ingrigimento dei capelli. Le anomalie della pelle possono essere presenti dalla nascita, mentra la spasticità solitamente insorge durante l’infanzia (Blumen et al., 2003) SPG24. Hodgkinson et al. (2002) hanno descritto una famiglia consanguinea dell’Arabia Saudita in cui 5 fratelli presentano paraplegia spastica. Il fenotipo paraplegico si manifesta ad 1 anno di vita quando gli individui affetti iniziano a stare in piedi. In seguito le caratteristiche sono la tendenza a camminare sulle punte, spasticità, andatura a forbice, clono e iperiflessia. Tre degli individui affetti e due soggetti non affetti della famiglia presentano ipoacusia neurosensoriale che segrega come tratto indipendente. Gli autori suggeriscono che il fenotipo di questa famiglia 36 

debba considerarsi “complicato” a causa della disartria spastica e dei segni pseudobulbari osservati nel probando, anche se questi sintomi non sono stati osservati in nessun altro membro della famiglia. SPG26. Una singola famiglia del Kuwait è stata descritta in linkage con il locus SPG26 (Wilkinson et al., 2005). Gli individui affetti tutti manifestano un esordio di paraparesi spastica tra i 7 e 8 anni. Le caratteristiche che complicano in fenotipo sono disartria, amiotrofia distale nelle braccia e nelle gambe, labilità emozionale e ridotto QI in tre dei cinque fratelli affetti. SPG28. Bouslam e coll. (2005) hanno studiato una famiglia consanguinea Marocchina in cui 3 membri presentano paraplegia spastica pura con perdita distale di sensitività negli arti inferiori e lieve interessamento degli arti superiori. L’età di esordio varia tra i 6 e i 15 anni. Il paziente con l’esordio più precoce presenta anche piede cavo e scoliosi. L’analisi di linkage dell’intero genoma ha identificato un locus candidato di malattia di 6.7 cM (5.5Mb) tra i marcatori D14S58 e D14S1064 sul cromosoma 14q21.3-q22.3. Non sono state identificate mutazioni nei geni SPG3A o GCH1 che mappano entrambi in questo intervallo. SPG30. Associata a questo locus è stata descritta una singola famiglia consanguinea di origini Algerine in cui 4 fratelli mostrano paraplegia spastica ereditaria (Klebe et al., 2006). L’età media di esordio è intorno ai 17.5 anni (range 12-21). Il fenotipo è caratterizzato da rigidità alle gambe e andatura spastica, altre caratteristiche cliniche sono iperiflessia agli arti inferiori e risposte plantari in estensione. Due fratelli hanno una perdita distale del sensorio, principalmente della sensibilità dolorifica, e due presentano movimenti oculari saccadici. Tre fratelli hanno sottili segni cerebellari e le neuroimmagini di uno dei due evidenzia diffusa atrofia cerebellare. La progressione della malattia è lenta, tutti i pazienti sono rimasti deambulanti per più di 15 anni dall’esordio di malattia. Gli autori osservano che il disturbo presentato in questa famiglia è una forma di SPG complicata con interessamento cerebellare e neuropatia periferica. SPG32. Stevanin e coll. (2007) hanno descritto una famiglia Portoghese consanguinea in cui tre fratelli presentano una paraplegia spastica complicata lentamente progressiva. L’esordio delle 37 

difficoltà nella deambulazione viene riferito dai pazienti intorno a 6-7 anni di età. L’esame clinico ha mostrato iperiflessia agli arti inferiori, ipostenia e spasticità a riposo e durante la deambulazione (con il bastone), così come risposte plantari in estensione e piede cavo. È presente ritardo mentale lieve e difficoltà di apprendimento. La MRI cerebrale di due pazienti mostra assottigliamento del corpo calloso (HSP-TCC), atrofia corticale e cerebellare, e disrafia pontina. Un paziente con una storia di abuso di alcohol ha sviluppato una neuropatia periferica. Analisi di linkage dell’intero genoma hanno permesso di identificato il locus candidato, SPG32, sul cromosoma 14q12-q21, con un intervallo di 30 cM. La regione si sovrappone parzialmente con l’inizio del locus SPG3A, ma l’analisi genetica non ha identificato mutazioni in atlastina. SPG35. Dick et al. (2008) hanno identificato un’ampia famiglia consanguinea dell’Oman in cui sette individui presentano paraplegia spastica. Gli individui affetti manifestano tra i 6 e gli 11 anni i primi segni neurologici e una rapida progressione nei successivi 2-4 anni con una conclamata spasticità degli arti inferiori e superiori con iperiflessia e risposte plantari in estensione, che determinano una perdita dell’autonomia a 25 anni. Caratteristiche variabili includono disartria, clono delle caviglie e un aumento del tono muscolare negli arti inferiori. Due individui presentano crisi epilettiche ben controllate, uno ha urgenza urinaria ed enuresi notturna, la maggior parte manifesta progressivo declino cognitivo. Le neuroimmagini del probando non hanno mostrato anomalie. Quattro pazienti sono diventati dipendenti da sedia a rotelle nella giovane età adulta e il disturbo ha reso impossibile una normale scolarizzazione. SPG45. Dursun e coll. (2009) hanno associato una nuova forma complicata autosomico recessiva di HSP (SPG45) ad una regione di 4.6 Mbp sul cromosoma 10q24.3-q25. Le manifestazioni cliniche sono costituite da paraplegia spastica ad esordio molto precoce accompagnata da ritardo mentale e segni oculari. Tutti i cinque individui affetti sono nati da genitori con riconosciuta consanguineità originari dallo stesso villaggio in Turchia, e i genitori dei pazienti sono sani. L’esame neurologico non ha incluso una dettagliata indagine neuropsicologica, ma l’osservazione che nessuno dei pazienti avesse raggiunto la capacità di leggere e scrivere è stata considerata dagli autori un segno di ritardo mentale. La MRI cerebrale è normale nell’unico paziente che l’ha effettuata. Tutti pazienti, 9 soggetti non affetti e 2 dei genitori sono stati sottoposti a visita oftalmologica. In alcuni soggetti della famiglia si è riscontrata miopia e in un

38 

paziente atrofia ottica. Nistagmo pendolare bilaterale è comune nella famiglia ed è considerato un nistagmo congenito. ARHSPs “late onset” di cui sono noti solo i loci: SPG14. In una famiglia italiana consanguinea associata al locus SPG14 le caratteristiche addizionali che co-segregano con la paraparesi spastica sono una neuropatia motoria distale e un ritardo mentale lieve (Vazza et al., 2000), con esordio variabile in età adulta. SPG25. Il fenotipo SPG25 è stato riportato in una famiglia italiana in cui i genitori sono cugini (Zortea et al., 2002). In questa famiglia, quattro individui affetti hanno sviluppato paraparesi spastica nella quarta e quinta decade. L’esordio della paraparesi spastica è stato preceduto o accompagnato da dolore alla schiena di tipo radicolare che si irradia agli arti inferiori. Le neuroimmagini hanno rivelato erniazioni del disco spesso a più di un livello. Tre dei quattro membri familiari affetti presentano positività alle indagini neurofisiologiche per una neuropatia periferica lieve, benché la caratteristica differisce in ciascun individuo. Il gene che causa la suscettibilità all’ernia del disco e la paraparesi spastica non è ancora stato identificato. I sintomi di esordio sono stati descritti in età adulta, tra i 30 e 46 anni. SPG27. Meijer e coll. (2004) descrivono un’ampia famiglia Franco Canadese in cui 7 su 14 figli presentano una forma pura di ARHSP con esordio in età adulta (25 a 45 anni). Tutti gli individui affetti manifestano una paraparesi spastica da moderata a grave, risposte plantari in estensione, vescica spastica e diminuzione da media a grave delle pallestesie ai piedi. Due individui presentano disartria. Solo un paziente è legato a sedia a rotelle. Gli studi sulla conduzione nervosa hammo nostrato potenziali di azione normali sensitivi e muscolari, ma i potenziali evocati somatosensoriali sono alterati in due pazienti. L’analisi di linkage a due-punti effettuata su questa famiglia dagli autori, con modello autosomico recessivo, ha identificato un locus putativo di malattia che è stato designato SPG27 sul cromosoma 10 (10q22.1-q24.1). Il locus critico di malattia abbraccia approssimativamente 26 Mb e parzialmente si sovrappone con il locus per SPG9, che è una forma distinta, autosomica dominante con fenotipo complicato. 39 

SPG43 (RISERVATO). Questa forma di HSP non è riportata nel database OMIM. In HUGO è indicato come fenotipo autosomico recessivo mappato al locus 19p13.11-q12, con la numerazione HGNC:35198. SPG46 (RISERVATO). Questa forma di HSP non è riportata nel database OMIM. In HUGO è indicato come fenotipo autosomico recessivo RISERVATO, con la numerazione HGNC:37080.

40 

Forme X-linked Rispetto alle HSP autosomiche, le HSP X-linked sono piuttosto rara. Sono forme complesse e sono spesso facilmente riconoscibili nella pratica clinica. Esistono 5 loci HSP Xlinked, per i quali sono stati identificati i geni SPG1 e SPG2 sono stati identificati, e i loro meccanismi molecolari sono relativamente ben compresi. 5 X-linked HSP

- 3 X-linked HSP i cui geni sono noti - “early onset”

- SPG1 (L1CAM) - SPG2 (PLP1) - SPG22 (SLC16A2)

- “early onset”

- SPG16 - SPG34

- 2 X-linked HSP di cui solo i loci noti

SPG1 (L1CAM). SPG1 è causata da mutazioni nel gene della L1 molecola di adesione cellulare (L1CAM) (Jouet et al., 1994). Il fenotipo tende ad essere complicato, con ritardo mentale e anomalie genetiche muscolo-scheletriche, caratteristcha l’agenesia dell’estensore lungo dell’alluce (Kenwrick et al., 1986) sin dalla prima infanzia. Mutazioni nello stesso gene sono state identificate nell’idrocefalo X-linked, agenesia X-linked del corpo calloso e sindrome di MASA (ritardo mentale, afasia, andatura paraplegica e pollice addotto). C’è una marcata variabilità interfamiliare e intrafamiliare in famiglie con mutazioni nel gene L1CAM. In un numero di famiglie più di uno dei possibili fenotipi L1CAM sono stati osservati. Le malattie sono ora considerate parte della sindrome clinica con l’acronimo CRASH, per l’ipoplasia del corpo calloso, il ritardo, il pollice addotto, la paraplegia spastica e l’idrocefalo (Fransen et al., 1995). L1CAM è una glicoproteina trans membrana, espressa principalmente dai neuroni e dalle cellule di Schwann (Joosten e Gribnau, 1998). La proteina ha 6 domini omologhi ai membri della superfamiglia delle immunoglobuline e 5 domini omologhi alla fibronectina di tipo III (Bateman et al., 1996). Le mutazioni identificate in L1CAM tendono a raggrupparsi in regioni lungo tutto il gene e possono essere divise in quelle mutazioni che agiscono principalmente alterando i domini proteici e quelle che si prevede alterino le proprietà di superficie della proteina. Le mutazioni che interessano i residui chiave nei domini erano probabilmente quelle che producono un più grave fenotipo CRASH con morte entro 1 anno di vita, in confronto a quelle che interessano i residui di superficie. Le mutazioni che interessano i domini della 41 

fibronectina erano più probabilmente quelle che producono un grave idrocefalo che quelle che interessano i domini delle immunoglobuline (Michaelis et al., 1998). SPG2 (PLP1). SPG2 è causata da mutazioni nel gene della proteina proteolipidica (PLP) (Saugier-Veber et al., 1994). Sono state descritte associate a questo locus sia famiglie con fenotipo puro che complicato di HSP (Johnson and McKusick, 1962; Bonneau et al., 1993; Cambi et al., 1996). La HSP complicata legata a SPG2 consiste di un fenotipo principale di paraparesi spastica, sindrome cerebellare e ritardo mentale. Una variazione intrafamiliare è stata osservata rispetto alle caratteristiche principali che ricorrono in vari gradi, con o senza caratteristiche aggiuntive quali l’atrofia ottica. I differenti tipi di mutazioni nel gene SPG2 si è supposto alterino la mielinizzazione, il che potrebbe spiegare le anomalie della sostanza bianca osservate alla MRI nei pazienti, e si correlano a fenotipi che spaziano da paraplegia spastica lieve ad esordio in età adulta alla grave malattia di Pelizaeus-Merzbacher. Mutazioni nel gene della proteolipoproteina all’Xq21-22 sono state individuate in famiglie con HSP principalmente complicata in cui potevano essere associate neuropatia periferica e cambiamenti della sostanza bianca alla MRI. Mutazioni (di solito duplicazioni) di questo gene inoltre danno origine alla malattia di PelizaeusMerzbacher (PMD), malattia dismielinizzante, la cui classica forma ha un esordio in infanzia e morte in tarda adolescenza o in giovane età adulta. E’ caratterizzata da nistagmo, atassia, spasticità, movimenti anomali, atrofia ottica e microcefalia. Esiste un più grave sottotipo che mostra una rapida progressione e morte nella prima decade (Renier et al., 1981). Le variazioni nel fenotipo tra Pelizaeus-Merzbacher e PLP1-HSP è ricondotta all’effetto differente che le mutazioni possono avere sulle due isoforme del prodotto della proteina, PLP1 e DM20. Il fenotipo della malattia causato da mutazioni nel gene PLP può essere considerato come uno spettro di continuità tra la SPG2 più lieve ad una estremità e la più grave PMD all’altra (Inoue, 2005). Le neuroimmagini in PMD e con minore estensione in SPG2 dimostrano una diffusa iperintensità di segnale della sostanza bianca sulle immagini T2, ricordando l’aspetto di un bambino appena nato (Inoue et al., 2001). PLP è la proteina più importante della mielina del CNS, poiché costituisce approssimativamente il 50% dellla mielina proteica totale nel cervello adulto. La isoforma DM20 della proteina è dovuta a splicing alternativo, manca di un residuo di circa 35 aa. La funzione di PLP/DM20 non è stata ancora chiarita. Sembra probabile che queste proteine giochino un ruolo nello stabilizzare e mantenere la guaina mielinica (Boison and Stoffel, 1994; Kluggmann et al., 1997). È stato ipotizzato anche un ruolo per la PLP/DM20 nella 42 

comunicazione glia/assone (Griffith et al., 1998). L’isoforma DM20 ha un ruolo precoce nello sviluppo e può giocare uno specifico ruolo nello sviluppo delle cellule gliali (Ikenaka et al., 1992; Peyron et al., 1997). Un’ampia gamma di mutazioni sono state descritte in PLP/DM20 che includono duplicazioni, mutazioni missenso, frameshift, non senso e di splicing. Le mutazioni puntiformi nell’esone 3b del gene PLP, codificante il segmento di 35 aa specifico di PLP e tagliato in DM20, tendono a produrre un fenotipo lieve di SPG2 (Saugier-Veber et al., 1994). Le mutazioni tronche che sono attese dare luogo ad una proteina non funzionale possono dar luogo a ad un fenotipo lieve di PMD o SPG2 (Bond et al., 1997). Questo è in contrasto con la maggior parte delle mutazioni puntiformi in PLP, che non ricadono nell’esone 3b, e portano allo sviluppo di un più grave fenotipo dismielinizzante PMD (Raskind et al., 1991; Inoue et al., 2002). Le duplicazioni, la forma più comune di mutazione riportata in PLP, sono anche associate con un fenotipo PMD. Queste correlazioni genotipo fenotipo suggeriscono che il fenotipo PMD derivi non da una riduzione nella PLP funzionale ma piuttosto da un guadagno tossico di funzione conferito da un cambiamento missenso o, nel caso della duplicazione genica, dal sovradosaggio di PLP wild type. SPG22 (SLC16A2). Allan-Herndon-Dudley syndrome (AHDS) è stata classificata come una forma complicata di HSP associata al locus SPG22 (Bohan e Azizi, 2004; Fink, 2004) ed è causata da mutazioni nel gene SLC16A2 che codifica il trasportatore dell’ormone tiroideo MCT8 (monocarboxylate transporter-8). La prima descrizione di AHDS è stata una famiglia multi generazionale in cui i maschi affetti presentavano un grave ritardo mentale e ipotonia alla nascita. Pochi individui non avevano mai camminato e nella vita adulta sviluppavano un’atrofia muscolare generalizzata, contratture articolari e iporeflessia (Allan et al., 1994). Ulteriori descrizioni negli anni hanno allargato il fenotipo ad includere la paraparesi spastica così come la disartria, l’atassia, i movimenti atetoidi, il mancato controllo del collo, ipoplasia muscolare, scoliosi, pectus escavatum, dimorfismi facciali (“long thin face”), padiglioni auricolari ampi e ipoplasia maxillare (Bundey and Griffiths, 1977; Claes et al., 2000). Una famiglia brasiliana con un fenotipo X-linked puro è stata inoltre legata al locus SPG22 (Starling et al., 2002). Uno studio di Maranduba et al., (2006) descrive caratteristiche cliniche che comprendono grave ritardo mentale con assenza di capacità di comunicazione, incapacità di sostenere la testa, tetraplegia spastica con contratture articolari, ridotta massa muscolare, distonia e nistagmo, l’anamnesi familiare mostrava disabilità lentamente progressiva e regressione nelle abilità acquisite.

43 

SPG16. Associata con SPG16 è stata descritta una forma X-linked rara di HSP è stata descritta. Gli individui affetti presentano tetraplegia, afasia motoria, riduzione del visus, ritardo mentale lieve, e disturbi sfinterici. È stata identificata una sola famiglia associata al locus SPG16 con un fenotipo puro che presenta una inserzione NOR (nucleolus organizer region) nel Xq11.2 (Tamagaki et al., 2000). In precedenza Steinmuller et al. (1997) hanno descritto una famiglia in cui i geni SPG1 e SPG2 erano stati esclusi e le analisi di linkage suggerivano un locus nella regione Xq11.2-q23. In questa famiglia il fenotipo era grave e complicato da ritardo mentale, coinvolgimento degli arti superiori, danno visivo e disfunzione vescicale e intestinale. Il gene per SPG16 rimane sconosciuto. L’esordio è descritto nella prima infanzia. SPG34. Macedo-Souza e coll. (2008) hanno effettuato uno studio di follow-up su una ampia famiglia Brasiliana studiata da Zatz et al. (1976), in cui 24 maschi attraverso 5 generazioni ereditavano una paraplegia spastica con interessamento solo degli arti inferiori. La modalità di ereditarietà è X-linked recessiva. L’esordio è durante la tarda infanzia o in adolescenza e la amalattia presenta una progressività molto lenta. Tutti gli adulti affetti mostrano andatura spastica e iperiflessia degli arti inferiori, non altre caratteristiche cliniche. Nello studio di Macedo-Souza (2008) per 11 uomini affetti il fenotipo è omogeneo con esordio tra i 12 e 25 anni. La malattia è lentamente progressiva e i pazienti necessitavano di ausili dopo due decadi. Negli arti superiori la forza non è mai compromessa, ma alcuni manifestano iperiflessia. Gli arti inferiori presentano spasticità progressiva e debilitante. Segno di Babinski, clono alle caviglie, e iperiflessia sono frequenti. Le pallestesie agli arti inferiori sono spesso ridotte dopo la sesta decade di vita; dolore spontaneo agli arti inferiori è comune. Non sono state riferite disfunzioni urinarie o sfinteriche.

44 

Casi sporadici Oltre alla storia familiare esistono altri parametri clinici che distinguono in modo affidabile la paraplegia spastica “ereditaria” da quella “apparentemente sporadica”. Sono frequenti nella pratica clinica soggetti senza storia di familiarità, diagnosticati come paraplegia spastica apparentemente sporadica (ASSP) (Fink, 2008). Dopo l’esclusione di altre diagnosi (ad es anomalie strutturali nell’encefalo o nel midollo spinale, leucodistorfie, sclerosi multipla, infezione da virus umano T-linfotrofico di tipo 1, distonia dopa-responsiva, sclerosi laterale amiotrofica o sclerosi laterale primaria) mediante MRI o analisi biochimiche, le mutazioni nei geni noti HSP dovrebbero essere sospettate. Mutazioni missenso in SPG4 sono state ritrovate in più del 18% dei casi sporadici (Depienne et al., 2006; Crippa et al., 2006) e tendono ad essere associate con fenotipi meno gravi che in pazienti con ADHSP. Casi “apparentemente” sporadici di HSPs dominanti possono risultare da dominanza incompleta o da mutazioni de novo. Casi sporadici possono anche corrispondere a ARHSP, soprattutto in pazienti consanguinei, siccome la maggior parte dei pazienti con disturbi autosomici recessivi nei paesi Europei e Nord Americani non hanno storie familiari positive. Brugman et al. (2008) hanno studiato due geni HSP, SPG4/spastina e SPG7/paraplegina, in 105 adulti Tedeschi con sindromi apparentemente sporadiche del motoneurone superiore (UMN). Questo studio conferma i risultati di precedenti lavori di Arnoldi e coll. (2008), Wilkinson e coll. (2004). Pazienti sporadici che portano due mutazioni nei geni SPG5, SPG7, o SPG11 sono stati riportati in numerosi studi (Fink, 2008).

45 

1.3.2 Diagnosi differenziale Indicazioni importanti per un corretto processo diagnostico di paraplegia spastica ereditaria sono l’età e la natura dell’esordio, la progressione dei sintomi, la presenza di una storia familiare, e poi altre caratteristiche cliniche. La diagnosi differenziale varia in accordo all’età di esordio. Diagnosi differenziali in paraplegia spastica (Warner TT., 2007): ESORDIO INFANTILE: -

Paralisi cerebrale diplegica

-

Anomalie strutturali (malformazione di Chiari, sublussazione atlanto-assiale)

-

Paraplegia spastica ereditaria (HSP)

-

Leucodistrofie (es. di Krabbe)

-

Dismetabolismi (abetaliproteinemia, deficit di arginasi)

-

Distonia levodopa-responsiva

-

Infezioni (mieliti)

-

Sclerosi multipla

ESORDIO IN ETA’ ADULTA: -

Patologia spinale degenerativa cervicale

-

Sclerosi multipla

-

Malattia del motoneurone (MND)

-

Neoplasma (tumore spinale primario/secondario, meningioma parasagittale)

-

Infezione (mieliti)

-

Malformazione arterovenosa durale

-

Malformazione di Chiari

-

Adrenoleucodistrofia

-

Paraplegia spastica erditaria (HSP)

-

Atassie spinocerebellari

-

Deficit di vitamina B12, deficit di vitamina E

-

Latirismo

-

Distonia responsiva levodopa

-

Infezioni (sifilide, HTLV-1, HIV)

-

Deficit di Rame

46 

La diagnosi di HSP pura in una famiglia in cui diversi membri hanno caratteristiche cliniche simili presenta poche difficoltà. L’età di esordio e la presentazione clinica possono aiutare i clinici a determinare quali test dovrebbero essere proposti, soprattutto per i casi complicati in età pediatrica in cui devono essere esclusi i dismetabolismi. Per un paziente per il quale non si osservi una storia familiare attendibile e verificabile, sono richiesti ulteriori accertamenti. Gli accertamenti diagnostici comprendono: -

gli acidi grassi a catena molto lunga,

-

enzimi cellulari,

-

gli aminoacidi plasmatici,

-

l’analisi delle lipoproteine sieriche,

-

vitamina B12,

-

vitamina E,

-

rame e ceruloplasmina,

-

serologia sierica per la sifilide,

-

HTLV-1,

-

HIV,

-

una valutazione neuroftalmologica.

L’esordio nei primi anni di vita con un ritardo nelle acquisizioni motorie è più suggestivo di paralisi cerebrale infantile (PCI), soprattutto se c’è un quadro clinico statico. Soprattutto in pazienti ad esordio precoce, confrontato con altre cause di paraplegia spastica, come la sclerosi multipla e il danno spinale, c’è una relativa preservazione della forza a dispetto di un drammatico incremento del tono nelle gambe. Per le forme pure di HSP sono state descritte diverse caratteristiche e queste includono anomalie lievi del sensorio agli arti inferiori (ad es riduzione delle pallestesie), sintomi urinari (riportati in oltre il 50% dei casi ad esordio tardivo), pes cavus e ritardo cognitivo lieve. Gli arti superiori possono presentare ipereflessia, ma i nervi cranici sono raramente coinvolti nelle HSP. HSPs complicate comprendono un largo numero di condizioni in cui la paraplegia spastica si accompagna ad altri sintomi, quali l’atassia, l’amiotrofia grave, l’atrofia ottica, la retinopatia pigmentaria, il ritardo mentale, segni extrapiramidali, la demenza, la sordità, l’ittiosi, la neuropatia periferica e l’epilessia. Queste forme sono spesso autosomiche recessive e sono rare, così la scoperta di sintomi neurologici addizionali con paraplegia spastica potrebbe indicare altre possibili diagnosi. 47 

Un caso sporadico di paraplegia spastica che si sviluppa oltre i 20 anni è un problema clinico abbastanza frequente in neurologia clinica. In questo caso l’assenza di storia familiare significa che la HSP è una diagnosi di esclusione. La paraplegia spastica apparentemente sporadica (ASSP) (Fink, 2008) può essere diagnosticata per un certo numero di anni finchè 1)

una mutazione patogenetica in un gene HSP venga identificata o emerga una

storia familiare, e la diagnosi viene cambiata in HSP; 2)

il disturbo progredisce a coinvolgere gli arti superiori, il linguaggio, e la

deglutizione, e la diagnosi viene cambiata in PLS (sclerosi laterale primaria); 3)

un’altra etiologia viene identificata (ad es. ALS, sclerosi laterale amiotrofica).

Le malattie del motoneurone (MNDs) sono un gruppo di disturbi eterogeneo etiologicamente che è caratterizzato dalla ipostenia muscolare e/o dalla paralisi spastica, che derivano da una degenerazione selettiva dei motoneuroni inferiori (LMNs) e/o dei motoneuroni superiori (UMNs), rispettivamente. Queste sindromi includono oltre alla HSP in cui la caratteristica principale è la degenerazione del motoneurone superiore, dei tratti corticospinali e delle colonne dorsali, la PLS (Sclerosi Laterale Primaria) in cui vi è degenerazione dei motoneuroni corticali e dei tratti corticobulbari e corticospinali, la SMA (atrofia muscolo spinale) in cui vi è relativamente isolata degenerazione delle cellule delle corna anteriori, la SLA (sclerosi laterale amiotrofica) con degenerazione mista dei tratti corticospinali e delle cellule delle corna anteriori. Nella Atassia di Friedreich la degenerazione è mista dei tratti corticospinali e delle fibre delle colonne dorsali. Esiste una sovrapposizione clinica, patologica e genetica rispetto anche ad altre malattie del motoneurone, quali la neuropatia ereditaria motoria distale (dHMN) e la neuropatia ereditaria motoria e sensitiva di tipo 2 (HMSN/CMT2). Altri esempi di malattie neurodegenerative che si manifestano anche con paraplegia spastica sono la sclerosi laterale primaria giovanile (JPLS) e la paralisi spastica ereditaria infantile ascendente (IAHSP). Insieme a JPLS (Juvanile PLS) e IAHSP (Infantile Ascending HSP), PLS è parte di un range di malattie che possono risultare da mutazioni ALS2. Secondo

la

localizzazione

primaria

del

deterioramento,

queste

patolgie

neurodegenerative sono neurologicamente caratterizzate da paralisi, spasticità e ipereflessia (HSP); da paralisi atonica, atrofia muscolare e iporeflessia (dHMN, SMA, CMT2); o da una combinazione di entrambe (ALS). Esiste qualche sovrapposizione tra PLS e HSP, siccome entrambe i disturbi sono caratterizzati da segni e sintomi puri di UMN. La sclerosi laterale primaria in età adulta 48 

(PLSA1) è un disturbo autosomico che interessa soltanto i UMNs nei tratti corticospinali e corticobulbari. La differenza tra PLSA1 e ALS adulta è basata sull’assenza di coinvolgimento del LMN in PLS. I due disturbi sono a volte considerati come disturbi neurodegenerativi progressivi clinicamente distinti, ma sebbene questo è probabile sia vero per molti casi di PLS, esistono pazienti che presentano segni puri UMN per anni ma più tardi progrediscono verso la ALS tipica. La ALS è la più comune MND ad esordio in età adulta, è di solito fatale entro 5 anni dall’esordio ed è caratterizzata dalla degenerazione di UMNs e LMNs. Circa il 5%-10% dei pazienti con ALS ha una storia di familiarità, e questi pazienti più frequentemente ereditano la malattia in maniera autosomica dominante. Gli studi di linkage hanno permesso di identificare 12 loci e 8 geni per sclerosi laterale amiotrofica familiare (FALS), e 3 loci per ALS con demenza frontotemporale (FTD). Sebbene questi risultati abbiano fornito preziose idee, queste spiegano solo una piccola frazione di tutti i casi ALS. La maggior parte dei casi ALS non hanno una chiara storia familiare e sono riferiti a casi sporadici di ALS (SALS). Ipotesi iniziali circa le cause di SALS principalmente erano considerate fattori ambientali; più recentemente, sono state proposte ipotesi sul il coinvolgimento di fattori epigenetici. Comunque ci sono sempre più evidenze che lasciano ipotizzare che fattori genetici anche contribuiscano a SALS. La SMA è una MND autosomica recessiva ed è una delle più comuni malattie genetiche che causa mortalità infantile. Si presenta con atrofia e ipostenia muscolare ed è causata da coinvolgimento del motoneurone inferiore. L’atrofia muscolare spino bulbare (SBMA) è stata la prima malattia da ripetizione di triplette identificata, dovuta all’espansione del trinucleotide ripetuto CAG che codifica il tratto poliglutamina (polyQ) nel primo esone del gene per il recettore androgeno (AR). SBMA è una malattia X-linked recessiva dovuta ad espansione della poliglutamina, come altre malattie da espansione della poliglutamina, è caratterizzata dalla formazione di aggregati. Si caratterizza per un’ipostenia lentamente progressiva degli arti e bulbare, con insorgenza tra i 30-50 anni, e interessa il motoneurone inferiore. Nella Charcot-Marie- Tooth di tipo 2A (CMT2A) è una “proteina motore” che causa di degenerazione degli assoni distali. Mutazioni nella kinesina a catena leggera (KIF1B) causa degenerazione degli assoni periferici. Le HSPs complicate con atassia cerebellare includono la ARSACS (Autosomica Recessiva Spastica Atassia di Charlevoix Saguenay), un disturbo in cui i fenotipi di HSPs e atassia cerebellare si sovrappongono. Nel 2000 (Engert et al., 2000) il gene SACS è stato identificato in pazienti provenienti dal Quebec. Inizialmente si è pensato che fosse costituito da un singolo esone lungo 12794 bp, codificante la proteina chaperone sacsina. In seguito è stato 49 

dimostrato che SACS è costituito da altri esoni codificanti in cui sono state identificate mutazioni (Grieco et al., 2004; Criscuolo et al., 2005; Ouyang et al., 2006). Ad oggi oltre 20 mutazioni nell’esone gigante sono state trovate in tutto il mondo, incluso Giappone, Italia, Tunisia, Turchia e Spagna. Il fenotipo è un’atassia spastica con esordio precoce, sempre prima dei 20 anni (per lo più prima dei 5 anni). Il fenotipo è tipicamente associato con anomalie del fundus, con atrofia o delle fibre retiniche mielinizzate o del nervo ottico. Sono state descritte famiglie senza anomalie ottiche ma con altri segni, quali ritardo mentale, distonia, sordità, o con atassia cerebellare pura senza spasticità (Harak et al., 2007; Shimazaki et al., 2007). Atrofia cerebellare è sempre visibile alla MRI, soprattutto nel verme superiore. Altri loci per atassie spastiche (la recessiva SAX2, ARSAL e la dominante SAX1) sono stati identificati ma i geni sono ancora sconosciuti (Meijer et al., 2002; Thiffault et al., 2006; Bouslam et al., 2007).

50 

1.3.3 Studi in vivo e ex vivo. Esame neurologico: L’esame neurologico (Fink, 2006) dei soggetti affetti da HSP prevede l’analisi dell’andatura poichè il disturbo del passo è il primo sintomo di HSP. Andatura di tipo spastico è osservata in tutti i soggetti con HSP, il modo in cui il passo è anomalo è spesso variabile tra individui. I soggetti HSP generalmente esibiscono ridotta lunghezza del passo dovuta a difficoltà nel sollevare le gambe e nella dorsiflessione del piede, variabili gradi di spostare anteriormente la base d’appoggio del piede (che va da attaccarsi al pavimento con la superficie medio-laterale plantare, il cuscinetto plantare, o camminare sulle punte), e una tendenza a strusciare le loro dita (dovuta a diminuita flessione dell’anca e della dorsi flessione del piede). La circonduzione, “l’andatura a forbice” (dovuta a spasticità dei muscoli aduttori), l’iperlordosi, e l’iperestensione delle ginocchia possono anche essere osservate. La capacità di camminare sui talloni è generalmente compromessa. Un’attenta analisi dell’andatura di ciascun paziente è utile per fornire specifiche indicazioni riabilitative e per determinare quali soggetti potrebbero beneficiare più di un trattamento di riduzione della spasticità e quali soggetti potrebbero beneficiare di ortesi anca-piede. L’esame neurologico degli individui con HSP non complicata rivelano ipereflessia degli arti inferiori, spasticità (soprattutto nei muscoli della loggia posteriore della gamba, adduttori, gastrocnemio-soleo), ipostenia (soprattutto nei muscoli della loggia posteriore della gamba, ileo psoas, e tibiali anteriori) e le risposte plantari in estensione (raramente, le risposte plantari rimangono in flessione malgrado l’ovvia spasticità dell’arto inferiore e l’ipereflessia patologica). Il coinvolgimento degli arti inferiori è tipicamente simmetrico (o quasi simmetrico). Piede cavo (equinismo) è comune nella HSP, sebbene possa essere assente in soggetti definitivamente affetti. La spasticità e l’ipostenia ricorrono in proporzioni variabili nelle HSPs. Sebbene alcuni pazienti presentino significativa ipostenia, altri pazienti manifestano solo marcata spasticità con nessuna ipostenia dimostrabile. Valutando i relativi contributi di ipostenia contro la spasticità aiuta determinare l’anadatura di quali pazienti dovrebbe beneficiare di un trattamento medico di riduzione della spasticità. E’ comune per soggetti con HSP non complicata avere riflessi lievemente aumentati agli arti superiori. Ciononostante ipereflessia lieve agli arti superiori nelle HSP non complicate non è accompagnata da spasticità degli arti superiori, ipostenia, lentezza dei movimenti, o ridotta destrezza e non produce disturbo funzionale. La paraplegia spastica che si associa con spasticità 51 

e ipostenia agli arti superiori lentamente progressiva e funzionalmente limitante dovrebbe far ipotizzare una diagnosi di PLS (sclerosi laterale primaria) piuttosto che una paraplegia spastica ereditaria non complicata. Nell’HSP non complicata pallestesie lievemente diminuite nelle dita sono un altro reperto frequente. La propriocezione e altre modalità sensoriali sono normali. La riduzione della sensibilità vibratoria, quando presente e non attribuibile ad altre cause (come una neuropatia periferica o una spondilosi cervicale), è un utile segno per distinguere L’HSP dalle fasi precoci di ALS (sclerosi laterale amiotrofica) e di PLS, nessuna delle quali coinvolge un deterioramento della colonna dorsale. La diminuizione delle pallestesie a livello distale nella HSP non complicata è lieve. Un grave disturbo della colonna dorsale non è tipico di HSP non complicate e potrebbe suggerire diagnosi alternative (quali l’atassia di Friedreich, la degenerazione combinata subacuta, e una sifilide terziaria) o disturbi coesistenti. Indagini di laboratorio e strumentali (MRI, neurofisiologia): Il ruolo primario di studi di laboratorio, neuroimmagini e neurofisiologici è escludere disturbi alternativi. Inoltre le neuroimmagini e gli studi neurofisiologici sono utili per valutare l’estensione del coinvolgimento neurologico, e per classificare con maggiore precisione il tipo di HSP. Questa informazione è utile per stimare la prognosi. Esami di laboratorio di routine come lattato sierico, piruvato, acidi grassi a catena lunga, ed esame del liquor sono normali in soggetti con HSP. Le immagini di risonanza magnetica dell’encefalo e del midollo spinale sono un’importante procedura per escludere altre frequenti condizioni neurologiche quali la sclerosi multipla, leucodistrofie ma anche per individuare anomalie associate come atrofie cerebellari o del corpo calloso così come anomalie della sostanza bianca (Depienne et al., 2007). MRI encefalo convenzionale è normale nelle HSP non complicate. MRI encefalo in diverse forme di HSP complicate rivela anomalie specifiche della sindrome come assottigliamento del corpo calloso in SPG11, anomalie cerebrali o cerebellari in SPG7, e idrocefalo in SPG1. La MRI del midollo spinale in HSP non complicate potrebbe essere completamente normale o mostrare atrofia, soprattutto del midollo spinale normale (Fink, 2006). Sebbene i reperti di immagini in risonanza magnetica di cervello e midollo spinale possano apparire normali in alcuni pazienti, c’è uno spettro di immagini in RM nei pazienti con HSP, che include atrofia lieve dell’encefalo e del midollo spinale, alta intensità di segnale in T2 nelle braccia posteriori della capsula interna, lesioni della sostanza bianca non specifiche,

52 

assottigliamento del corpo calloso, e atrofia dell’encefalo e cerebellare soprattutto nelle aree motorie e nel giro pericentrale (Lesca et al., 2003; Hourani et al., 2009). Uno studio quantitativo di imaging in RM in 3D del volume cerebrale ha dimostrato una marcata atrofia cerebrale associata con HSP in confronto a controlli di varie età, ed era più grave e coinvolgeva entrambe sostanza grigia e bianca nelle forme complicate di HSP (Kassubek et al., 2006). Un altro importante reperto è l’anomala intensità di segnale alta in T2 nelle braccia posteriori della capsula interna a livello delle fibre discendenti dei tratti corticospinali e corticobulbari, che si estende dalla corona radiata attraverso il braccio posteriore della capsula interna fino al tronco encefalo (Hourani et al., 2009). In letteratura sono state anche descritte lesioni iperintense non specifiche della sostanza bianca periventricolare e nel centro semiovale soprattutto nelle aree temporoparietali. Sono rilevanti nei pazienti più anziani, suggerendo una progressiva degenerazione assonale e un avanzato stato di malattia. Nello studio proposto da Hourani et al. (2009) queste lesioni della sostanza bianca erano lievi, osservate nel 67% dei pazienti, ed erano leggermente più evidenti nei pazienti più anziani che in quelli più giovani all’interno della stessa famiglia. Questa osservazione può riflettere sia la penetranza genica sia un accumulo di lesioni correlato all’età. Queste lesioni non specifiche della sostanza bianca dovrebbero essere attentamente interpretate poiché alcuni studi dimostrano che non c’è una significativa differenza tra pazienti con HSP e una popolazione sana della stessa età (Cambi et al., 1995). Un reperto radiologicoimportante in HSP è un corpo calloso ridotto. Era stato descritto nelle forme complicate autosomico recessive legate al cromosoma 15q13-q15, soprattutto in pazienti Giapponesi (Krabbe et al., 1997; Nakamura et al., 1995; Kuru et al., 2005). Corpo calloso assottigliato è stato descritto in pazienti con HSP autosomico dominante correlato a mutazione nel gene della spastina (Orlacchio et al., 2005). L’etiologia di un assottigliamento del corpo calloso è ancora oggetto di dibattito riguardante se secondario a ipoplasia congenita o ad atrofia progressiva. Alcuni autori la considerano un’ipoplasia che ricorre precocemente nel corso della malattia, e lo spessore del corpo calloso rimane stabile nel tempo e nel corso dei follow-up (Kuru et al., 2005). Casali et al. (2004) avevano riportato casi con progressivo assottigliamento del corpo calloso e ipotizzato una progressiva atrofia del corpo calloso, un processo neurodegenerativo secondario a grave gliosi nella sostanza bianca cerebrale. Hourani et al. (2009) riportano atrofia del corpo calloso nel 44% dei pazienti studiati, predominante nel lato posteriore del corpo calloso e associata con alterazioni della sostanza 53 

bianca nella corona radiata posteriore e nelle aree peritrigonali, in cui c’è una relazione tra la localizzazione e la gravità delle alterazioni della sostanza bianca e l’atrofia del corpo calloso, suggestive di un processo atrofico del corpo calloso, in opposizione a precedenti casi descritti da Teive et al. (2001) e da Somasundaram et al. (2007), in cui l’assottigliamento era principalmente lungo il lato anteriore del corpo calloso e associato con atrofia del lobo frontale. Le nuove tecniche di imaging RM sono state raramente usate in studi su pazienti con HSP (Dreha-Kulaczewski et al., 2006) come - spettroscopia in risonanza magnetica, - DTI, diffusion tensor imaging, - SPECT, single-photon emission CT, - FDG-PET, fluorodeoxyglucose􏰃positron-emission tomography. La spettroscopia in MR a protoni single voxel ha rivelato ridotte concentrazioni di Nacetilaspartato (NAA), creatina (Cr) e colina (Cho) e elevati livelli di mio inositolo. Queste anomalie hanno mostrato progressione durante un periodo di 5 anni. NAA è un marker neuronale; la sua riduzione indica perdita di tessuto neuroassonale. Cr è un marker dell’energia del metabolismo ed è ridotto in aree di diminuita attenuazione cellulare. Cho è un marker della sintesi e degradazione di membrana ed è un marcatore del turnover della mielina; una ridotta concentrazione è stata vista nella ipomielinizzazione e nelle dismielinizzazione. Il mioinositolo è un marker della proliferazione degli astrociti (Moller-Hartmann W et al., 2002). Queste alterazioni metaboliche sono consistenti con la progressiva perdita neuroassonale e la proliferazione di astrociti che è nota ricorrere in HSP. DTI ha mostrato aumentata diffusività media e ridotta anisotropia frazionale nella sostanza bianca periventricolare, compatibile con assoni danneggiati mielinizzati. SPECT e FDG-PET hanno dimostrato diminuito flusso sanguigno e ipometabolismo nel talamo e nella corteccia frontale, temporale e parietale (Winner et al., 2004). Un follow-up longitudinale clinico e neuroradiologico (Okubo et al., 2000; Ohnishi et al., 2001) ha dimostrato un’ulteriore diminuizione del flusso sanguigno relativo cerebrale nel talamo e nella corteccia cerebrale suggestivo di coinvolgimento progressivo talamico e della corteccia cerebrale. A livello del midollo spinale, gli studi di Sperfeld et al. (2005) hanno mostrato una significativa atrofia del midollo spinale superiore in pazienti con HSP confrontati con i controlli, entrambe a livello cervicale e toracico. Uno studio di Krabbe et al. (1997) hanno dimostrato una significativa diminuizione nel diametro anteroposteriore del midollo spinale a livello di T3 e T9 in pazienti con HSP pure autosomico dominanti confrontati con i controlli, che corrispondeva a livello neuropatologico alla degenerazione dei tratti corticospinali, dei tratti piramidali non 54 

incrociati, e del fascicolo gracile (colonne posteriori del midollo spinale) dal livello lombare su al livello superiore cervicale. Un altro studio di Hedera et al., (2005) avevano mostrato diminuizione nell’area cross-sezionale del midollo spinale ai livelli C2 e T9 confrontati con i controlli sani. L’atrofia midollare era più importante in pazienti HSP SPG6 e SPG8 piuttosto che in soggetti con tipi SPG3A e SPG4. I precedenti studi di MRI non potevano analizzare separatamente l’ampiezza dei differenti tratti del midollo spinale anteriori (discendenti) e posteriori (ascendenti) responsabili per la gran parte dell’atrofia del midollo spinale. Comunque questi studi speculavano che l’atrofia fosse soprattutto secondaria alla degenerazione del tratto piramidale discendente, risultando in una marcata atrofia a livello toracico e non a livello cervicale. Anche altri autori avevano descritto atrofia lieve del midollo spinale cervicale e toracico (non quantificata) (Durr et al., 1994; Lesca et al., 2003; Nicolau et al., 1987; e Nielsen et al., 1998). Sebbene questo reperto non sia molto conclusivo nel confermare la diagnosi di HSP, può essere utile nella valutazione della degenerazione della colonna dorsale. Gli studi di conduzione nervosa (NCS) in elettromiografia (EMG) sono di solito normali nella HSP non complicata. Una neuropatia subclinica sensoria è stata descritta in HSP non complicate (Shady et al., 1990; 1994). Al di la della classica distinzione in HSP “non complicate” e “complicate”, un certo numero di forme di HSP (SPG10, SPG14, SPG15, SPG26, SPG3A, SPG36) sono associate con neuropatia periferica ed è stato dimostrato un coinvolgimento del motoneurone secondario. La degenerazione assonale nelle HSP non complicate spesso coinvolge le fibre delle colonne dorsali in aggiunta ai tratti corticospinali. I potenziali evocati somatosensoriali registrati dagli arti inferiori spesso mostrano un ritardo di conduzione (Battistella et al., 1997). Quando presente questo reperto aiuta a distinguere soggetti HSP da quelli in cui la spasticità agli arti inferiori è una fase della PLS o ASL (in cui pallestesie e funzione della colonna dorsale sono normali) (Fink, 2001). La velocità di conduzione del tratto corticospinale, misurata attraverso potenziali corticali evocati, è spesso ridotta in HSP. Sebbene i potenziali evocati corticali registrati dalle gambe spesso mostrano ridotta velocità di conduzione o ampiezza (Schulte et al., 2003; Claus et al., 1995), quelli registrati da segmenti spinali cervicali sono tipicamente normali o mostrano una velocità di conduzione solo lievemente ridotta (Claus et al., 1990). La biopsia muscolare in alcuni ma non in tutti i soggetti con HSP legata a SPG7 (dovuta a mutazioni nella metalloprotease mitocondriale paraplegina) mostra fibre rosse frastagliate e fibre negative per la citocromo ossidasi C (De Michele et al., 1998). L’anomalia mitocondriale 55 

non è una caratteristica generale di tutti i tipi di HSP. Biopsie muscolari e analisi degli enzimi per la fosforilazione ossidativa sono risultate normali in HSP autosomico dominanti “non complicate” SPG3A, SPG4, SPG6, e SPG8 (Fink, 2006).

Neuropatologia: Studi post-mortem di pazienti con HSP non complicate mostrano degenerazione assonale limitata al sistema nervoso centrale (CNS) che interessa soprattutto le estremità distali delle più lunghe fibre motorie discendenti (tratti corticospinali con massimo coinvolgimento nel midollo spinale toracico) e le estremità distali delle più lunghe fibre ascendenti (fibre del fascicolo gracile, con massimo coinvolgimento nella regione cervico-midollare). Sono stati pubblicati finora pochi lavori riguardanti la neuropatologia dell’HSP, quasi esclusivamente dedicati alle forme pure di HSP (Reid, 1999; McDermott et al., 2000; Wharton et al., 2003). In accordo a questi articoli si è creduto che le caratteristiche centrali e coerenti neuropatologiche della HSP pura costituiscono un danno alle porzioni terminali dei più lunghi tratti discendenti (ad es., tratti corticospinali laterale e eventrale) e ascendenti (ad es, fascicolo gracile) all’interno del midollo spinale, che possono essere accompagnate da una aggiuntiva degenerazione delle celule piramidali di Betz dello strato V nella corteccia motoria primaria, del cervelletto e dei tratti spino cerebellari (Sauter et al., 1999; McDermott et al., 2000; Wharton et al., 2003). La maggiore caratteristica neuropatologica della HSP pura è una assonopatia che dipende dalla lunghezza (Schwarz, 1952; Schwarz and Liu, 1956; Behan and Maia, 1974; Kramer, 1977; Sack et al., 1978; Bruyn, 1992). Le porzioni terminali dei lunghi assoni dei tratti corticospinali discendenti e delle colonne dorsali ascendenti sono più gravemente affetti. Di conseguenza la perdita assonale è più grave nella regione lombare dei tratti corticospinali e nella regione cervicale delle vie della colonna dorsale (soprattutto nel lungo fascicolo gracile). La degenerazione è anche stata osservata nei tratti spinocerebellari approssimativamente nella metà dei casi riportati. Le radici dorsali dei gangli, le radici posteriori e i nervi periferici sono di solito normali. In uno studio quantitativo su 6 casi HSP, l’area dei tratti corticospinali, la densità assonale e il numero degli assoni erano ridotte a tutti i livelli (Deluca et al, 2004). Nella regione lombare il numero degli assoni era ridotto del 56% in confronto ai casi controllo. Il rapporto tra numero degli assoni del tronco encefalo e lombare era significativamente più grande nei casi HSP in confronto ai controlli, suggerendo distalmente una più grande perdita assonale. Simili risultati erano stati dimostrati nei tratti delle fibre sensitive con un 56% di riduzione nel numero degli assoni nel fascicolo gracile in confronto con i controlli. Il più corto fascicolo cuneato ha 56 

mostrato una riduzione nel numero degli assoni di minor grado e questo non raggiunge significatività statistica (23%). Queste osservazioni supportano fortemente l’ipotesi che la HSP è una assonopatia legata alla lunghezza in cui la degenerazione inizia nelle porzioni terminali degli assoni più lunghi e procede in maniera retrograda verso il corpo cellulare. E’ stato ipotizzato che il corpo cellulare fosse relativamente non colpito dai processi degenerativi fino a tardi nel corso della malattia e che isolati report di una riduzione nel numero delle cellule di Betz riflettesse un avanzato stato nel processo della malattia (Schwarz e Liu, 1956). Comunque report patologici hanno iniziato a dimostrare la citopatologia in HSP (White et al 2000; Wharton et al., 2003). La citopatologia dai casi post-mortem per la spastina supportano il concetto che la patogenesi di SPG4 coinvolga la disregolazione del citoscheletro. Queste osservazioni correlano con le osservazioni in modelli cellulari e studi molecolari. Le fibre che innervano gli arti inferiori sono le prime ad essere interessate, a supporto dell’ipotesi che il trasporto assonale, il traffico intracellulare e/o il mantenimento delle fibre lunghe fossero specificamente danneggiati in HSP, un ipotesi che è stata confermata dall’identificazione di geni coinvolti in queste funzioni e attraverso l’analisi di modelli animali. In aggiunta alle fibre lunghe altre strutture cerebrali quali il cervelletto, i gangli della base, la corteccia cerebrale, o la sostanza bianca (incluso il corpo calloso), possono essere interessati nelle forme complicate di HSP, come evidenziato dalla MRI (Franca et al., 2007). Degenerazione del talamo è stata descritta per la prima volta in un paziente con una forma complicata di HSP, non caratterizzato geneticamente, che aveva sofferto di paraplegia spastica progressiva, disartria deterioramento cognitivo, così come sintomi emozionali (Yanase et al., 2004). Seidel et al. (2009) hanno condotto uno studio neuropatologico del cervello di una paziente con una HSP complicata, non caratterizzata geneticamente, che mostrava un danno diffuso, con alterazioni degenerative nel cervelletto, corteccia cerebrale, talamo, tronco encefalo e midollo spinale. Gli autori vorrebbero dimostrate che le alterazioni neurodegenerative osservate nella paziente studiata offrono spiegazioni ai sintomi motori, psichiatrici, e neuropsicologici. Secondo gli autori, in funzione di ruoli fisiologici noti delle strutture nervose centrali affette, un sottogruppo di sintomi di malattia clinicamente osservati nella paziente HSP potrebbero essere spiegati sulla base dei reperti trovati nello studio neuropatologico.

57 

1.3.4 Scala di valutazione funzionale (SPRS): Nel 2003 il GeNeMove (German Network for Hereditary Movement Disorders) è stato fondato per la ricerca sui rari disturbi genetici del movimento in Germania. Un trial multicentrico è stato condotto da una task force del GeNeMove, che consiste di specialisti dei disturbi del movimento provenienti da sei università tedesche, per sviluppare e validare una Scala di Valutazione per la Paraplegia Spastica (SPRS) come misura della gravità e della progressività di malattia. Schule et al. (2006) hanno descritto la scala SPRS come strumento di misura affidabile e valido del grado di disabilità. Questa scala di 13-item è stata costruita per valutare il deterioramento funzionale che avviene in forme pure di paraplegia spastica (SP). Sintomi aggiuntivi che costituiscono una forma complicata di SP vengono registrati in una lista a parte. L’applicazione di SPRS richiede meno di 15 minuti e non richiede nessuna strumentazione speciale, adatta per un setting di pazienti ambulatoriali. La concordanza della SPRS era alta (ICC=0.99) e l’affidabilità era ulteriormente supportata da una alta consistenza interna (Cronbach α = 0.91). I valori di SPRS erano quasi normalmente distribuiti senza un apparente “effetto di pavimento e tetto”. La validità del costrutto è stata dimostrata attraverso un’alta correlazione delle SPRS all’indice di Barthel e alla ICARS (validità convergente) e bassa correlazione al MMSE (validità discriminante). La costruzione di SPRS è stata basata sui seguenti punti: 1) SPRS deve valutare il danno funzionale e perciò non includere segni neurologici senza implicazioni funzionali come la presenza del riflesso plantare in estensione o l’ipereflessia tendinea; 2) SPRS deve porre l’attenzione sulle caratteristiche chiave della HSP pura; le caratteristiche complicanti devono essere registrate in una lista di segni e sintomi complicanti; 3) SPRS deve essere pratica. Nessun equipaggiamento speciale deve essere necessario per somministrare la scala; gli items devono basarsi sule procedure dell’esame obiettivo neurologico standard. SPRS è adatta per tutti i sottotipi di HSP incluse le forme familiari e sporadiche così come i fenotipi puri o complicati. Questa scale per la valutazione della disabilità utilizza procedure di esame neurologico standard nella maggior parte dei suoi items, le istruzioni per effettuare il test e il punteggio dovrebbero essere brevi per molti items serza compromettere la concordanza. Completare la SPRS richiede meno di 15 minuti e non richiede strumenti particolari. La lista 58 

delle caratteristiche complicate è adattata all’esame neurologico di routine e evita tests aggiuntivi che portano via molto tempo. SPRS è uno strumento particolarmente adatto per un setting ambulatoriale. L’età pediatrica è stata esclusa dal processo valutativo di SPRS. Le tappe principali dello sviluppo motorio sono inseparabilmente intrecciate con una probabile progressione di malattia nei bambini affetti; una rappresentazione differenziata di queste complesse interrelazioni in un punteggio non specializzato per questo scopo sembra impossibile. Di conseguenza SPRS non è adatto a differenziare tra cambiamenti evolutivi ed età correlati del sistema motorio e cambiamenti dovuti a progressione di malattia. Sono state usate scale esistenti come la Scala di Ashworth per la valutazione della spasticità e la Medical Research Council Scale (Scala del Concilio di Ricerca Medico) per la valutazione della forza muscolare. Ciascun item della scala deve discriminare 5 gradi (0 a 4), dove 0 rappresenta nessun interessamento e 4 il massimo grado di gravità. Il punteggio risultante è calcolato aggiungendo singoli punteggi a ciascuno dei 13 items, risultando in un massimo punteggio di 52. Per ogni singolo item, l’intero punteggio è stato raggiunto dai singoli pazienti cui è stata somministrata nello studio preliminare (Schule et al., 2006). Comunque nessun paziente ha raggiunto la somma massima di punteggio di 52 punti. Questa costruzione aiuta a prevenire che il paziente riceva un massimo punteggio alla SPRS prima che lo stadio finale di malattia sia raggiunto (ceiling effect-“effetto tetto”), siccome SPRS dovrebbe essere capace di rappresentare la progressione anche in stadi di malattia molto avanzati. SPRS distingue quasi perfettamente tra pazienti SP e controlli sani, ha mostrato di essere sensibile ai sintomi SP anche in stadi precoci di malattia e ciò argomenta contro un effetto “floor”. SPRS è correlata solo moderatamente con la durata di malattia, la variabilità nella progressività della malattia tra sottotipi risulta in un danno variabile dopo una durata fissa di malattia e riduce la correlazione tra gravità di malattia e durata. (Per lo specifico protocollo si rimanda al paragrafo 7.1)

59 

1.4

Ipotesi sui meccanismi patogenetici La maggior parte delle HSPs sono associate a neurodegenerazione piuttosto che a sviluppo

anomalo. Questa neurodegenerazione è stata caratterizzata in studi istopatologici come un meccanismo di “dying back” degli assoni dipendente dalla lunghezza nel tratto corticospinale e nella colonna dorsale. L’identificazione di geni associati con HSP è utile per spiegare le cause della malattia a livello molecolare.

1.4.1 Trasporto assonale e traffico di membrana I neuroni del tratto corticospinale sono altamente polarizzati e i loro assoni possono crescere più di un metro in lunghezza. La funzione normale in questi neuroni è criticamente dipendente dal corretto traffico dei componenti di membrana. Dagli studi su diversi geni causativi di HSP è derivata l’ipotesi che ci siano interruzioni del trasporto assonale di macromolecole e organelli, che colpiscono prevalentemente le parti distali di questi neuroni (Crosby et al., 2002; Soderblom et al., 2006). Come risultato della morfologia unica dei neuroni spinali, i lunghi assoni (che possono misurare oltre 1 metro in lunghezza) sono molto probabilmente molto suscettibili ai meccanismi di trasporto di membrana, al trasporto associato ai microtubuli e all’organizzazione citoscheletrica. Inoltre dipendono da funzioni mitocondriali per guidare in modo efficiente il trasporto di segnali, molecole e organelli alla parte terminale dei nervi. Per cui il traffico di membrana e il trasporto assonale sono il motivo ricorrente emergente e potenzialmente importante nelle HSP. Trasporto assonale. Il trasporto assonale principalmente dipende dai microtubuli, ed è alimentato da due distinte classi di molecole motori, vale a dire la dineina (trasporto retrogrado) e le kinesine (soprattutto trasporto anterogrado). La dineina citoplasmatica è un motore ubiquitario della famiglia delle AAA (ATPasi associate con varie attività cellulari), e comprende molte subunità responsabili per l’aggancio ai microtubuli e il reclutamento del carico. La dineina è necessaria per un’ampia varietà di processi cellulari, quali la divisione cellulare e il mantenimento del Golgi, e i neuroni sono molto dipendenti dal corretto funzionamento di questo complesso molecolare per il loro trasporto assonale. Infatti la dineina è coinvolta nel trasporto assonale di numerosi carichi, quali gli endosomi neurotrofina-segnale, mitocondri, segnali generati da una lesione, e proteine associate all’RNA. 60 

La famiglia delle kinesine comprende diversi membri, alcuni dei quali sono responsabili per il rilascio di materiale alle terminazioni nervose. La kinesina 1 è composta da due catene pesanti e due catene leggere. Le catene pesanti contengono sia domini ATPasi che domini di legame ai microtubuli, mentre le catene leggere si pensa siano selettive per il riconoscimento del carico. Il mantenimento della trama citoscheletrica inoltre dipende dai motori molecolari, che sono responsabili del trasporto di corti microtubuli e neurofilamenti laddove sono richiesti per la crescita e il riparo. Componenti importanti per il processo di rimodellamento dei microtubuli sono quelle proteine che tagliano i microtubuli in frammenti brevi. Traffico di membrana. Tutte le cellule hanno un sistema di traffico di membrana regolato, dinamico che consente le interazioni tra la membrana plasmatica e altri compartimenti cellulari legati alla membrana. Questo traffico è altamente organizzato e comincia con la gemmazione delle vescicole, seguito dal trasporto delle vescicole, tethering e fusione con la membrana bersaglio. Endocitosi inizia con la formazione di una vescicola alla membrana plasmatica che contiene recettori o altre proteine transmembrana, ed è legata sul rivestimento proteico della vescicola, la clatrina. Le vescicole vengono trasportate lungo i microtubuli, e quindi tethering e fusione degli endosomi avviene per rilasciare il carico alle varie localizzazioni subcellulari. Questi processi dipendono da alcune famiglie di proteine, come la famiglia di piccole GTPasi Rab, che media la destinazione intracellulare delle vescicole, e le proteine associate-ESCRT (complesso di smistamento endosomiale richiesto per il trasporto: endosomal sorting complex required for transport), che smista le proteine bersaglio per la degradazione ubiquitina-dipendente. Il pathway di secrezione fluisce nella direzione opposta all’endocitosi, dal reticolo endoplasmatico (ER) e dall’apparato di Golgi, e permette la distribuzione di proteine di nuova sintesi, carboidrati e lipidi alla superficie cellulare, endosomi e lisosomi. 8 geni causativi HSP e le rispettive proteine codificanti sono coinvolti nella disfunzione del trasporto assonale e del traffico di membrana come causa di HSP:

61 

1)

SPAST/ Spastina

2)

ATL1/ Atlastina GTPase 1

3)

KIF5A/ Kinesina membro della famiglia 5A

4)

NIPA1/ Non imprinted nella sindrome di Prader-Willi/Angelman 1

5)

ZFYVE26/ Spastizina

6)

SPG20/ Spartina

7)

SPG21/ Maspardina

8)

SPG11/ Spatacsina.

SPG4/ Spastina. I casi associati a SPG4 costituiscono circa il 40% dei casi HSP autosomico dominanti, rendendo le mutazioni in questo gene la più comune causa di HSP. Oltre 150 mutazioni sono state descritte in SPG4, che codifica la spastina, un membro della famiglia delle proteine ATPase-associate (AAA), che sono componenti della dineina motore e sono coinvolte nel trasporto assonale retrogrado (Hollenbeck et al., 2005; van Niekerk et al., 2007). La spastina è presente in differenti isoforme che dipendono dalla traslazione del codone iniziale (ATG) usato e dallo splicing degli esoni, in particolare l’esone 4. Questo ha una grandezza prevista fino a 616 amminoacidi. Un lavoro sperimentale ha ipotizzato che il secondo ATG, che dà luogo a una isoforma più corta, è il codone di inizio principale, sebbene uno studio recente in ratti abbia scoperto che l’isoforma più lunga fosse espressa a concentrazioni più alte nei neuroni del midollo spinale piuttosto che in altri neuroni. La spastina possiede due domini di struttura principali, un dominio MIT (interazione con il microtubulo e traffico- Microtubule Interacting and Trafficking) nell’N-terminale e un dominio catalitico AAA nel C-terminale. Le oltre 150 mutazioni sono state descritte in tutti gli esoni, eccetto che nell’esone 4. Queste mutazioni principalmente missenso e non senso, interessano il dominio AAA della spastina, suggerendo una perdita di funzione nella patogenesi di HSP. Più recentemente è stato dimostrato che riarrangiamenti genici, in particolare delezioni esoniche, sono un causa comune di malattia. I neuroni sembrano essere sensibili all’aploinsufficienza della spastina poichè mutazioni che danno luogo ad entrambe le forme della proteina normale e aberrante sono sufficienti a produrre il quadro clinico completo. Studi cellulari hanno dimostrato che la spastina mutata colocalizza con i microtubuli e l’over-espressione della spastina wilde-type porta a disassemblaggio dei microtubuli. Nei motoneuroni la spastina è abbondante in regioni cellulari in cui si trovano i microtubuli dinamici, come gli assoni distali. Studi comparativi in neuroni primari su spastina e katanina, un enzima di taglio dei microtubuli connesso alle AAA, suggerisce che il taglio dei microtubuli mediato dalla spastina è coinvolto soprattutto nella ramificazione assonale. L’overespressione di spastina nei neuroni di ippocampo di ratto causa un drammatico aumento nella formazione di ramificazioni assonali associato con un incremento nel numero di microtubuli corti, tagliati. La deplezione della spastina porta a neuroni con assoni più corti con un numero inferiore di ramificazioni. Questi risultati sono in accordo con la crescente evidenza 62 

che la spastina ha un ruolo nel turnover dei microtubuli, e la attività di taglio dei microtubuli della spastina è stata confermata da studi in vitro. Le mutazioni in AAA cassette inoltre aboliscono questa attività di taglio della spastina. La spastina potrebbe avere un’ulteriore attività di impacchettamento (“bundling”) dei microtubuli, così come può impacchettare i microtubuli polimerizzati in vitro, e forme mutate possono indurre stabilizzazione dei microtubuli quando overespresse in linee cellulari. Il coinvolgimento della spastina nel pathway endocitico deriva dalla scoperta di un legame della spastina alla proteina 1B modificatrice della cromatina, una proteina associata con il compesso di smistamento endosomiale, probabilmente mediato dal dominio MIT. Una parziale co-localizzazione della spastina con un marcatore endosomiale ed uno del RE è stata inoltre riportata, portando all’ipotesi che la spastina potrebbe funzionare nella regolazione dei microtubuli responsabile del movimento assonale degli organelli di membrana. Recenti studi biochimici hanno dimostrato che la spastina possa formare esameri che si legano alla tubulina polimerizzata inducendo un cambio conformazionale che è responsabile della rottura dei microtubuli. Le mutazioni correlate a malattia sembrano interferire con anelli porosi in questa struttura esamerica. Numerose mutazioni in spastina soprattutto ampie delezioni, mutazioni che esitano in proteine tronche e cambi non senso, agiscono attraverso una perdita di funzione, ma questo non sembra essere l’unico meccanismo patogenetico (Solowska et al., 2008). Sono state studiate forme patogenetiche di spastina mutata iniziate dal primo codone ATG, questa isoforma di piena lunghezza era stata trovata in concentrazioni più alte nei neuroni di midollo spinale di ratto durante l’età adulta, ma non in altri neuroni. Espressione sperimentale di un peptide disfunzionale nei neuroni che comprenda la regione N-terminale (aa 1-273) espressa dal primo codone ATG, era deleteria per la crescita assonale. Espressione di questo peptide negli assoni giganti di calamaro ha inibito il trasporto veloce assonale, mentre l’espressione di un peptide corto simile tradotto dal secondo codone ATG non aveva questi effetti deleteri. Questi studi sulla spastina implicavano un’interruzione dei processi che mantengono il citoscheletro di microtubuli, che in succesione potrebbe agire sfavorevolmente sul trasporto assonale e portare ad una anomala crescita assonale o degenerazione. Le differenti mutazioni in SPG4 portano quindi ad aploinsufficienza o a guadagno di funzione, e l’interazione della spastina con CHM1B indica che la spastina è anche coinvolta nel pathway endocitico e nella formazione dei “midbody” durante la citocinesi (Yang et al., 2008). ATL1/ Atlastina GTPase 1.

63 

L’atlastina è una proteina di 64 kDa localizzata soprattutto nel cervello, nei neuroni piramidali e nella corteccia cerebrale e nell’ippocampo (Zhao et al., 2001b; Zhu et al., 2003). Zhu et al. (2003) hanno clonato per primi SPG3A, e l’hanno chiamato atlastina-1. La proteina che ne deriva di 558 aminoacidi contiene un motivo di legame GTP nel suo Nterminale e 2 domini trans membrana alla metà del suo C-terminale. Ha anche 3 potenziali siti di N-glicosilazione. L’espressone di atlastina-1 appariva più alta nei tessuti cerebrali di uomo e di ratto, e più bassa in altri tessuti umani, inclusi la muscolatura liscia, il surrene, il rene e il polmone. L’atlastina-1 si autoassocia formando omotetrameri di circa 230 kD. Zhu et al. (2003) hanno dimostrato la sua attività GTPasica. Poiché la proteina è probabilmente attiva come tetramero, si è ipotizzato un effetto dominante-negativo della mutazione. Esistono tre isoforme per la ATL1, le prime due differiscono per lo splicing alternativo dell’esone 14, mentre il terzo trascritto differisce nel 5’ UTR confrontato con la variante1, la risultante isoforma b ha gli stessi N- e C- terminali ma è più corto se confrontato con l’isoforma a. Le varianti 2 e 3 codificano entrambe per l’isoforma b (Muriel et al., 2009; Hu et al., 2009; Chan et al., 2009; Louriero et al., 2009; Smith et al., 2009). Sulle basi della sua somiglianza con le proteine appartenenti alla superfamiglia delle dinamine delle ampie GTPasi e di studi in sistemi eterologhi di culture cellulari, l’atlastina 1 si ritiene possa essere implicata nella emissione dei neuriti (Zhu et al., 2006; Namekawa et al., 2007) e nel traffico di membrana intracellulare, soprattutto all’interfaccia RE-Golgi. Le funzioni della famiglia dell’atlastina sembrano essere principali nella morfogenesi del RE e del Golgi, ma non sembra essere richiesta nel traffico anterogrado RE-al-Golgi. La morfogenesi anomala del RE e del Golgi potrebbe interferire con una corretta distribuzione di membrana o polarità dei neuroni corticospinali. In neuroni in cultura, l’atlastina 1 è aumentata nei coni di crescita e promuove l’allugamento degli assoni durante lo sviluppo neuronale. Questa proteina dinamina/guanilato binding (GBP) con domini transmembrana ha mostrato diverse localizzazioni subcellulare: reticolo endoplasmatico, cis-Golgi, strutture vescicolari nei coni di crescita assonale, varicositi, e punti di diramazione assonale, che hanno suggerito un ruolo funzionale nel traffico intracellulare ma anche nello sviluppo assonale, che è coerente con l’età di esordio precoce nei pazienti SPG3A. Alcune mutazioni in atlastina-1 interessano l’attività guanosino trifosfato della proteina e sembrano interessare l’estroflessione vescicolare dal reticolo endoplasmatico o il loro segnale al Golgi, che potrebbe essere in connessione con l’interazione dell’atlastina con p24, una proteina della famiglia p24/emp/gp25L.

64 

Atlastina e Spastina interagiscono direttamente, il dominio N-terminale della spastina si lega direttamente al dominio C-terminale citoplasmatico della atlastina, il che suggerisce un pathway comune di patogenesi (Sanderson et al., 2006; Evans et al., 2006). Orso et al. (2009) hanno dimostrato che l’atlastina in Drosophila localizza sulle membrane del reticolo endoplasmatico e la sua perdita causa frammentazione del RE. L’atlastina in Drosophila integrata in distinte membrane ha la capacità di formare complessi trans-oligomerici, e la sua sovra-espressione induce un allargamento del profilo del RE, in accordo con una eccessiva fusione delle membrane del RE. Esperimenti in vitro hanno confermato che l’atlastina conduce autonomamente la fusione delle membrane in modo GTP-dipendente. Mentre l’atlastina con deficit di GTP-asi è inattiva, incapace di formare complessi trans-oligomerici che portano al fallimento dell’autoassociazione, e incapace di promuovere la fusione in vitro. I risultati di Orso et al. (2009) hanno dimostrato che l’atlastina media l’assemblamento e la fusione di membrana e suggeriscono che è l’attività GTPasica necessaria per la fusione omotipica del RE. KIF5A/ Kinesina membro della famiglia 5A. KIF5A è un membro del gruppo di proteine della kinesina a catena pesante. KIF5A è espressa esclusivamente nei neuroni e forma parte del complesso kinesina I, un motore dei microtubuli responsabile per il trasporto veloce anterogrado dal corpo cellulare neuronale all’assone distale microtubulo-dipendente (Xia et al., 1998; Goldstein and Yang, 2000; Goldstein, 2001). Studi in vitro hanno mostrato che forme mutate di KIF5A portano ad una riduzione del flusso di trasporto lungo i microtubuli dovuta ad una riduzione della affinità per i microtubuli o della velocità di scorrimento, e un deficit nel carico kinesina-dipendente perciò probabilmente sta alla base della degenerazione terminale degli assoni. La mutazione N256S identificata in una famiglia interessa un residuo non variante di asparagina (Reid et al., 2002). In proteine omologhe questo residuo è cruciale nell’attività ATPasi sui legami ai microtubuli (Yun et al., 2001). Nell’omologa di Saccaromyces cerevisiae, la mutazione Kar3 che interessa lo stesso residuo disaccoppia nucleotide e legame del microtubulo al motore, dando luogo ad un blocco della stimolazione microtubulo-dipendente dell’attività del motore ATPase (Song e Endow, 1998). Un simile effetto è stato visto con la stessa mutazione nella Kinesina motore Ncd di Drosophila (Song e Endow, 1998). Un altro cambio missenso identificato (R280C) interessa un residuo di arginina altamente conservato e si ipotizza possa cauare un cambio strutturale che altera il legame con i microtubuli (Fichera et al., 2004). 65 

NIPA1/ Non imprinted nella sindrome di Prader-Willi/Angelman 1. La proteina NIPA1 è una proteina transmembrana neurone-specifica principalmente localizzata nel comparto endosomiale precoce e sulla membrana plasmatica, dove si pensa svolga funzione di trasportatore del magnesio (Goytain et al., 2007). Le mutazioni patogeniche missenso impediscono il trasferimento della proteina dagli endosomi alla membrana plasmatica. Un guadagno di funzione dominante negativo è probabilmente responsabile per questo effetto, poichè ampie delezioni del gene non determinano un fenotipo HSP. L’introduzione di mutazioni NIPA1 umane nell’ortologo nipa1 della Caenorhabditis elegans causa neurodegenerazione. La deplezione di NIPA1 nell’ortologo di Drosophila melanogaster, la spictina, suggerisce che abbia anche un ruolo nel trasporto assonale. L’ortologo di NIPA1 in drosophila (spictina) interagisce con recettori della proteina morfogenetica dell’osso e promuove la loro internalizzazione dalla membrana (Wang et al., 2007). Il signaling della proteina morfogenetica dell’osso è necessario per l’assemblaggio normale del citoscheletro microtubulare, e le mutazioni NIPA1 potrebbero perciò interferire con il trasporto assonale allo stesso modo. ZFYVE26/ Spastizina. I casi SPG15 sono associati con mutazioni che causano proteine tronche in ZFYVE26, che codifica una proteina zinco finger chiamata spastizina, e ha un fenotipo caratteristico autosomico recessivo complicato. L’iniziale studio cellulare della spastizina indicava che colocalizza con marcatori endosomiali e del reticolo endoplasmatico, e che si pensa sia coinvolta nel traffico di membrana a questi livelli (Hanein et al., 2008). SPG20/ Spartina. Le HSP dovute a mutazione in SPG20 sono una forma autosomico recessiva, la sindrome di Troyer. La sindrome di Troyer è causata da una mutazione frameshift (1110delA) nel gene SPG20, le mutazioni identificate producono proteine tronche, implicando una perdita di funzione (Patel et al., 2002). Il gene SPG20 codifica una proteina di 666 aminoacidi (72.7 kDa) chiamata spartina (spastica paraplegia autosomica recessiva della sindrome di Troyer) ubiquitariamente espressa nei tessuti adulti. La spartina presenta omologia con le proteine umane SNX15, VPS4 e Skd1 coinvolte nel traffico proteico, suggerendo un ruolo simile per la spartina. La spartina condivide omologia con la regione N-terminale della spastina, possiede un dominio MIT (dominio N-terminale per l’interazione con i microtubuli e il traffico), suggerendo una funzione simile (Patel et al., 2002; Ciccarelli et al., 2003). In tal senso è stata associata ad 66 

una funzione di trasporto, ma ci sono dati contrastanti che riguardano la sua localizzazione subcellulare, a livello mitocondriale, o con una distribuzioni nucleare e citoplasmatica. E’ stata implicata nell’endocitosi e nel trasporto del recettore del fattore di crescita epidermiale (Bakowska et al., 2007) ed è stata trovata in strutture simil-sinaptiche, neuriti e rete trans-Golgi in neuroni differenziati (Robay et al., 2006). La associazione della proteina attraverso i microtubuli con i mitocondri viene persa quando è mutata (Lu et al., 2006). Questo ha fatto ipotizzare che la Troyer syndrome possa essere causata da difetti nel trasporto dei mitocondri mediato dai microtubuli. La spartina si ritiene sia associata alla superficie di gocce lipidiche e ne regoli la grandezza e il numero (Bakowska et al., 2007). SPG21/ACP33/ Maspardina. Le HSP associate con SPG21 sono forme autosomico recessive. Un’inserzione nucleotidica nel gene SPG21 esita in una proteina tronca ACP33/maspardina che sottende questo disturbo, suggerendo un meccanismo di perdita di funzione (Simpson et al., 2003). Prima che fosse identificato il suo coinvolgimento in HSP la maspardina era stato supposto colocalizzasse con vescicole della rete endosomiale/trans-Golgi, ipotizzando un ruolo nel trasporto della proteina e nello smistamento, e anche con vescicole transferrina positive (Zeitlmann et al., 2001). Uno studio recente ha confermato che essa localizza soprattutto al citoplasma nonchè alle membrane, probabilmente agli ultimi compartimenti endosomiali della rete trans Golgi (Hanna et al., 2009). SPG11/ Spatacsina. Mutazioni frameshift, non senso e di splicing nel gene KIAA1840 che codifica la spatacsina sono state identificate in molte famiglie con HSP associata a SPG11, ipotizzando un meccanismo di perdita di funzione. La spatacsina è ubiquitariamente espressa nel sistema nervoso, soprattutto nel cervelletto, nella corteccia cerebrale, e nell’ippocampo. Possiede almeno un dominio trans membrana e gli esperimenti in immunofluorescenza hanno mostrato una diffusa espressione citosolica, con una sfumata colocalizzazione nei mitocondri e nel RE, ma non c’è associazione con il Golgi o con i microtubuli. Ad oggi la patogenesi di questa forma di HSP è sconosciuta, sebbene la scoperta di accumulo di materiale membranoso pleomorfo in assoni non mielinizzati di una biopsia di un nervo surale da un paziente con HSP associata a SPG11 è stata interpretata come compatibile con trasporto assonale disturbato.

67 

1.4.2 Funzioni mitocondriali Mitocondri e HSP I mitocondri generano ATP attraverso l’attività dei complessi della catena respiratoria. Deficits di energia intracellulare ricorrono quando le attività dei complessi mitocondriali della catena respiratoria sono disturbati. Altre conseguenze dannose intracellulari di disfunzioni mitocondriali includono: aumentata generazione di specie reattive all’ossigeno, stress ossidativo e danno dell’omeostasi del calcio intracellulare. Il ruolo del danno mitocondriale e dello stress ossidativo in altre malattie neurodegenerative come l’atassia di Friedreich, malattia del motoneurone e malattia di Huntington è ben riconosciuto (Manfredi e Beal, 2000). I corpi cellulari dei lunghi assoni interessati in HSP devono supportare processi assonali molto lunghi. 3 geni causativi HSP supportano un ruolo per la disfunzione mitocondriale: 1)

SPG7/ Paraplegina,

2)

HSPD1/HSP60/ Heat shock 60-kDa protein 1,

3)

REEP1/ Receptor expression-enhancing protein 1.

SPG7/ Paraplegina. Mutazioni in SPG7, che codifica la paraplegina costituiscono circa il 5% delle HSPs autosomiche recessive. Paraplegina è una proteina nucleare codificata nel mitocondrio che comprende 795 amminoacidi. Mutazioni nella paraplegina causano forme pure e complicate di HSP, e i pazienti con queste mutazioni hanno difetti nella fosforilazione mitocondriale ossidativa (Casari et al., 1998). La precisa funzione della paraplegina è sconosciuta, esistono studi su proteine omologhe di lievito, Afg3, Rca1 e Yme1. Queste proteine di lievito, come la paraplegina sono membri della classe di proteine AAA. Appartengono al sottogruppo delle metalloproteasi, dissimili dalla spastina che appartiene al gruppo meiotico delle proteine AAA. Nel lievito Afg3 e Rca1 formano un complesso ad alto peso molecolare localizzato all’interno della membrana mitocondriale dove svolgono diversi ruoli che includono: partecipare all’assemblaggio della sintesi dell’ATP, la formazione del complesso della catena respiratoria e la degradazione di polipeptidi mitocondriali non completamente sintetizzati (Tauer et al., 1994; Tzagoloff et al., 1994; Rep and Grivell, 1996). La delezione o una mutazione di un sito proteolitico conservato di Afg3p o Rca1p porta a disfunzione della attività della catena respiratoria e diminuita capacità degradativa dei polipeptidi mitocondriali non completamente sintetizzati. Proteine simili alla 68 

paraplegina, AFG3L2 e YME1L1, sono state identificate nell’uomo, e sono altamente omologhe allo stesso gruppo delle proteine del lievito (Banfi et al., 1999; Coppola et al., 2000). AFG3L2 è anche localizzata all’interno della membrana mitocondriale dove forma un complesso di 900 kD con la paraplegina, e possiede attività proteolitica (Atorino et al., 2003). In fibroblasti in cultura da pazienti SPG7nil il complesso AFG3L2-paraplegina era assente. I fibroblasti SPG7 hanno un’incrementata sensibilità allo stress ossidativo ed una ridotta attività del complesso I della catena respiratoria che potrebbe essere migliorata dalla espressione esogena di paraplegina wild type. La perdita del complesso delle metallo-proteasi AAA in fibroblasti da pazienti con HSP associata a SPG7 causa ridotta attività del complesso I nella catena respiratoria mitocondriale e aumenta la sensibilità allo stress ossidativo (Arnoldi et al., 2008; Wilkinson et al., 2004). I topi nulli per la paraplegina sviluppano rigonfiamenti assonali a causa di un accumulo di mitocondri e neurofilamenti. Questo evento precede la degenerazione assonale ma correla con l’esordio di danno motorio, perciò lascia ipotizzare che sia il trasporto assonale sia la disfunzione mitocondriale possano essere implicate e che la malattia sia dovuta alla perdita di funzione della paraplegina. I meccanismi attraverso cui un deficit di paraplegina possono interrompere la funzione mitocondriale includono: un accumulo di proteine anomale o ripiegate male (misfolded) nella membrana interna mitocondriale, l’incompleta formazione della catena respiratoria e un danneggiato turnover di una proteina mitocondriale regolatoria. I risultati proposti nello studio su fibroblasti SPG7, che ipotizza un fallimento nel corretto assemblaggio del complesso I causato dalla mancanza del complesso AFG3L2-paraplegina, fornisce un’ulteriore contributo sui meccanismi di disfunzione mitocondriale. In SPG7 sembrerebbe che la causa principale della disfunzione mitocondriale possa essere un disturbo nel trasporto assonale. I meccanismi patogenetici in SPG7 sono complessi, anche a causa di un ampio numero di polimorfismi missenso, che sono più spesso trovati in stato eterozigote. Questo complica grandemente l’analisi genetica (Arnoldi et al., 2008). Una disfunzione mitocondriale indicata dalla presenza di fibre muscolari negative per la citocromo c ossidasi sono state riportate in tre famiglie con mutazioni nella paraplegina (Casari et al., 1998; McDermott et al., 2001). Altri autori hanno riportato danni biochimici consistenti in una riduzione delle attività del complesso I e del complesso II/III ma non cambi istochimici nelle biopsie muscolari da individui con SPG7 (Wilkinson et al., 2004). HSPD1/HSP60/ Heat shock 60-kDa protein 1.

69 

La chaperonina mitocondriale heat shock protein 60 (HSP60/ HSPD1) mutata in famiglie con forme pure di HSP autosomica dominante, si manifesta con forme ad esordio tardivo. HSP60 è parte di un complesso multimerico ben caratterizzato che si pensa suppporti il folding di un sottogruppo di proteine localizzate nei mitocondri. Uno studio cellulare da un paziente con la mutazione Val98Ile ha dimostrato una diminuita espressione delle proteasi per il “controllo di qualità mitocondriali” Lon (ATP-dipendente proteasi La) e ClpP (ATP-dipendente proteasi Clp sub unità proteolitica) ad entrambe i livelli dell’mRNA e delle proteine (Hansen et al., 2008). È stata proposta in un recente lavoro una mutazione missenso in HSPD1 associata a pazienti con esordio precoce che presentano una mutazione patogenetica in spastina (Hewamadduma et al., 2008). Una riduzione nell’attività degradativa del sistema di “controllo di qualità” proteica nei mitocondri nella HSP associata a HSPD1 si è pensato porti alla conseguente disfunzione mitocondriale. REEP1/ Receptor expression-enhancing protein 1. REEP1 codifica la proteina 1 recettore expression enhancing, localizzata nei mitocondri. Questa proteina si suppone possa essere coinvolta in attività chaperone-like. Sono state identificate mutazioni che interessano i siti di riconoscimento dei microRNA nella regione 3’UTR che possono alterare la stabilità degli mRNA. I microRNA rappresentano piccole molecole non tradotte che si legano a specifici siti bersaglio di 7-8 nucleotidi nella regione 3’UTR degli mRNA, e inibiscono la traduzione e alterano il trascrizione e la stabilità (Bartel, 2004). L’omologo della proteina REEP1 in lievito (Yop1P) interagisce con le proteine Rab ed è implicata nella morfologia tubulare nel reticolo endoplasmatico. Sebbene la localizzazione mitocondriale di REEP1 sia evidente, la sua funzione su questo o su altri organelli rimane da chiarirsi (Zuchner et al., 2006; Beetz, 2008).

1.4.3 Mantenimento e assemblaggio della mielina e migrazione neuronale I geni causativi di alcune HSPs sono coinvolti nella mielinizzazione. 2 geni causativi HSP che sottendono a due forme X-linked recessive di HSP sono: 1)

L1CAM/ Molecola di adesione cellulare L1 (L1CAM),

2)

PLP1/ Proteolipido proteina 1 (PLP1).

70 

L1CAM/ Molecola di adesione cellulare L1 (L1CAM). L1CAM è una glicoproteina trans membrana, principalmente espressa dai neuroni e dalle cellule di Schwann (Joosten e Gribnau, 1998). La proteina ha 6 domini omologhi ai membri della superfamiglia delle immunoglobuline e 5 domini omologhi alla fibronectina di tipo III (Bateman et al., 1996). L1CAM gioca un ruolo essenziale nello sviluppo del sistema nervoso, essendo coinvolta nell’adesione neurone-neurone, nella crescita assonale e nel pathfinding (Brummendorf e Rathjen, 1996). L1CAM gioca un importante ruolo nella formazione dei tratti corticospinali (Cohen et al., 1997; Dahmne et al., 1997; Frase net al., 1998; Demyanenko et al., 1999). PLP1/ Proteolipido proteina 1 (PLP1). Le mutazioni in PLP1 sono causa di una forma complicata di HSP (SPG2) e della malattia di Pelizaeus-Merzbacher (PMD). PLP1 e la sua isoforma più piccola DM20 sono proteine di membrana integrali che costituiscono circa il 50% del contenuto proteico della mielina del sistema nervoso centrale adulto. Mutazioni nell’esone 3 di PLP1 potrebbero esitare prevalentemente in SPG2 piuttosto che in PMD perché questo esone è escluso da DM20. Viceversa si ha la malattia PMD solo quando DM20 è interessata da mutazione. Le due proteine mieliniche, PLP e DM20, essendo componenti strutturali della guaina mielinica e hanno un ruolo rilevante nella maturazione degli oligodendrociti. Il preciso meccanismo attraverso cui le mutazioni in PLP causano HSP non è chiaro, ma potrebbero esserne la causa l’alterazione della mielinizzazione del tratto cortico-spinale, forse a causa di effetti di tossicità sugli oligodendrociti indotti da un anomalo traffico intracellulare. In un modello di topo con una mutazione nulla di PLP1 è stato dimostrato il danno del trasporto veloce anterogrado e retrogrado. Alla autopsia di pazienti con mutazioni nulle PLP1 è evidente una perdita assonale che dipende dalla lunghezza degli assoni nel SNC. Ci sono tre meccanismi ipotizzati per produrre il fenotipo PMD/SPG2 (Inoue, 2005). Innanzitutto i cambiamenti conformazionali della proteina PLP secondari a mutazioni puntiformi porta ad un accumulo di PLP malassemblata nel reticolo endoplasmatico. L’accumulo di proteina misfolded può scatenare il pathway di risposta della proteina non ripiegata che può portare ad apoptosi degli oligodendrociti. Con le duplicazioni genomiche la PLP in eccesso si accumula nei tardi endosomi/lisosomi con il colesterolo. Questa aggregazione può sconvolgere il normale traffico della mielina necessaria per la normale mielinizzazione. Nelle mutazioni in cui PLP non è tradotta, si forma una mielina compatta in assenza di PLP. Questa mielina è fragile e incline ai successivi cambiamenti di demielinizzazione. Inoltre 71 

l’assenza di PLP porta all’interruzione delle interazioni melina-assone, dando luogo alla degenerazione assonale. Nel topo plp-nullo la degenerazione può essere secondaria ad interruzione nel trasporto assonale rapido causata dall’assenza di PLP/DM20 (Edgar et al., 2004).

1.4.4

Altri meccanismi etiopatogenetici

Sono noti i geni causativi di altre forme HSP, per le quali le disfunzioni che sottendono alcune mutazioni hanno fatto ipotizzare differenti pathway che possono portare alla malattia, ma i meccanismi patogenetici rimangono largamente sconosciuti. Sono riportati qui di seguito 7 geni causativi HSP per i quali poco è noto, come le proteine codificanti: CYP7B1/ Citocromo P450, famiglia 7, sottofamiglia B, polipeptide 1. Nel fegato CYP7B1 offre un pathway alternativo per la degradazione del colesterolo, mentre nel cervello interviene nel metabolismo dei neurosteroidi. Nel fegato, infatti, gli acidi biliari richiesti per il normale assorbimento dei lipidi e delle vitamine solubili con i lipidi, vengono prodotti dal colesterolo attraverso due processi metabolici: il classico meccanismo che coinvolge CYP7A1 (colesterol-7α-idrolasi) e il meccanismo acido che coinvolge CYP7B1. Queste idrossilasi rappresentano anche delle molecole chiave per il metabolismo del colesterolo nel cervello. Dato che il trasferimento del colesterolo dal sangue al cervello avviene in piccole quantità, la maggior parte del colesterolo è prodotta localmente nel cervello. CYP7B1 catalizza la 7α-idrossilazione del 27-idrossicolesterolo (Martin et al., 1997), del deidropiandrosterone (DHEA) e del pregnenolone nel cervello (Rose et al., 1997). Il DHEA e il pregnenolone sono neurosteroidi attivi che giocano un ruolo importante nello sviluppo neuronale e nell’attivazione dell’N-metil-D-aspartato (Baulieu et al., 1998; Compagnone et al.,1998). La 7α-idrossilazione del DHEA è uno step metabolico importante nel cervello e può contribuire alla regolazione della concentrazione e dell’attività dei neurosteroidi nel cervello (Robel et al., 1995). Dal punto di vista strutturale il gene CYP7B1 codifica per una proteina di 506 residui amminoacidici e mostra il 40% di identità di sequenza con il gene umano colesterol-7α-idrossilasi (CYP7A1). Entrambe i geni contengono sei esoni e cinque introni. Il gene CYP7B1 di 65 Kb ed è molto più lungo del gene CYP7A1. Questo potrebbe essere spiegato ammettendo che CYP7A1 derivi da CYP7B1 in seguito ad una duplicazione del gene o ad un evento di conversione genica. E’ stato ipotizzato che il meccanismo etiopatogenetico della forma di HSP SPG5A, come in quella associata a 72 

PLP1, possa influire sullo sviluppo precoce degli assoni (in funzione anche dei casi ad esordio precoce) prima che sulla degenerazione piuttosto attraverso anomalie nel metabolismo del colesterolo, componente importante della mielina. SLC33A1/ Acetyl-CoA trasporter. Una mutazione nel gene SLC33A1 (solute carrier family 33, member 1) che codifica il trasportatore dell’acetil-CoA (ACATN, AT1), è stata recentemente associata ad una nuova HSP (SPG42). ACATN trasporta la acetil-CoA nel lumen dell’apparato di Golgi e si ritiene abbia un ruolo nella crescita e nel mantenimento degli assoni dei motoneuroni. La proteina SCL33A1 di 549 aa contiene 6 a 10 domini trans membrana e un “leucine zipper motif” nel III dominio trans membrana (Kanamori et al., 1997). Esperimenti di immunofluorescenza hanno indicato che la proteina di 58-kD è localizzata al citoplasma. Usando saggi in vitro con cellule semi-intatte Kanamori et al. (1997) hanno dimostrato che la proteina AT1 (o SLC33A1) è un trasportatore dell’acetil-coA che è coinvolto nel processo di O-acetilazione. Attraverso studi di ibridizzazione in fluorescenza in situ, Bora et al. (1998) hanno mappato il gene Acatn nel topo al cromosoma 3E1-E3. La diversità strutturale e la complessità delle catene di zuccheri nei gangliosidi di membrana sono causate in parte dalla ricorrenza di diverse differenti specie di molecole di acido acetilsialicilico, incluse le forme O-acetilate. L’acetilazione dei residui di acido sialicilico delle glicoproteine e dei gangliosidi avviene nel lumen del Golgi, usando l’acetil-coA come donatore di acetato. La transversione in eterozigosi c.339T>G nell’esone 1 del gene SLC33A1 (Lin et al., 2008), associata al fenotipo SPG42, determina una sostituzione ser113-arg (S113R) all’inizio del secondo dominio trans membrana, che è atteso invertire l’orientamento di tutti i domini successivi nell’analisi in silico con SOSUI. È stato dimostrato che il knockdown di scl33a1 in D.rerio causa una crescita assonale difettiva a livello del midollo spinale dei pesci (Lin et al., 2008; Hirabayashi et al., 2004). GJA12/GJC2/ Connessina 47. Una nuova forma di HSP complicata, lentamente progressiva (SPG44) è stata associata ad una mutazione missenso proteina gap junction, gamma 2 (GJC2), che codifica per la connessina 47 proteina gap junction (CX47), per ora riportata riportata in una sola famiglia (OrthmannMurphy et al., 2008). I canali CX47-CX43 sono coinvolti nel normale mantenimento della mielina. L’espressione di CX47 mutata in un modello di cultura cellulare indica che può ancora formare placche di gap junction con CX43, sebbene abbiano “gating” voltaggio-dipendente

73 

gravemente alterato che è previsto non funzionare in condizioni fisiologiche. Gli autori propongono per SPG44 un meccanismo di perdita di funzione (Othmann-Murphy et al., 2008). KIAA0196/ Strumpellina I casi SPG8 sono associati con mutazioni nel gene KIAA0196, che codifica per la strumpellina (Valdmanis et al., 2007). La funzione della strumpellina e le modalità di azione dei prodotti mutati rimangono sconosciute. In D.rerio sia il knockdown del suo omologo che l’espressione della proteina umana mutata erano state viste produrre assoni motori più corti e anomalie nella ramificazione assonale. BSCL2/ Seipina. Il gene mutato nella Silver syndrome, BSCL2, codifica per la proteina seipina, una proteina integrale di membrana del reticolo endoplasmatico (Windpassinger et al., 2004). La Silver syndrome è geneticamente eterogenea come dimostrato dai casi clinici pubblicati di fenotipi Silver syndrome senza linkage con SPG17 o mutazione in BSCL2 (Patel et al., 2001; Warner et al., 2004; Windpassinger et al., 2004). Analisi Norther-blot hanno rivelato uno specifico trascritto cerebrale BSCL2 di circa 1.8 kb e un trascritto ubiquitariamente espresso di 2.2 kb. Entrambe i trascritti sono tradotti in una proteina di 398 amminoacidi. BSCL2 è costituito da 11 esoni ed entrambe le mutazioni descritte (N88S e S90L) ricadono nell’esone 3 e distruggono una attesa N-glicosilazione della proteina. Gli esperimenti di transfezione in cellule NSC34 hanno dimostrato che la seipina mutata formava aggregati nel citoplasma. Tale effetto sembrerebbe secondario alla perdita del sito di glicosilazione nella seipina mutata che sarebbe atteso condurre alla formazione di seipina male assemblata e disfunzionale, incline alla aggregazione. La funzione della seipina si pensa agisca all’interfaccia del RE con goccioline lipidiche. In uno studio è stato dimostrato che la seipina mutata nella HSP associata a BSCL2 sembra accumularsi nel RE e aumentare la concentrazione di molecole del RE stress-mediate, che inducono apoptosi in cellule in cultura (Ito, 2009). PNPLA6/ Neuropathy target esterase. L’enzima NTE è presente nei neuroni e deacila il maggior fosfolipide di membrana, la fosfatidilcolina (PtdCho). Mutazioni nel gene PNPLA6 (patatin-like phospholipase domain containing 6) codificante per la NTE (neuropathy target esterase), causano degenerazione distale dei lunghi assoni spinali nell’uomo, producendo lo stesso effetto dell’avvelenamento da organo fosfati, inibitori chimici della NTE. Eppure analoghi cambiamenti neuropatologici non sono 74 

stati riportati nei topi nestin-cre:NTEfl/fl con deficit di NTE nei tessuti neuronali. Inoltre l’alterata omeostasi di PtdCho non è stata individuata in vertebrati con deficit di NTE. Nei topi nestin-cre:NTEfl/fl sostenuti rialzi di PtdCho su molti mesi erano stati accompagnati da progressiva degenerazione ed enormi rigonfiamenti degli assoni nei tratti spinali sensori e motori e da crescenti disfunzioni alle zampe posteriori. La distribuzione delle lesioni assonali assomiglia strettamente a quella nella paraplegia spastica ereditaria (HSP). L’importanza di un difettoso traffico di membrana in HSP e l’associazione di NTE con il reticolo endoplasmatico, punto di partenza per il pathway secretorio e il trasporto di materiale neuronale negli assoni, suggerisce di approfondire il ruolo di NTE nei processi di secrezione. Neuroni in cultura con deficit di NTE hanno mostrato danni secretori modesti, coerenti con la sopravvivenza neuronale e il danno “in vivo” inizialmente ristretto alle porzioni distali degli assoni più lunghi (Read 2009).

75 

1.4.5 Modelli animali Spastina (SPG4) Per studiare l’effetto dell’attività della spastina e delle mutazioni in vivo sono stati condotti studi su vari modelli animali di HSP che hanno dimostrato un effetto della spastina sul trasporto e sulla crescita assonale. Knockdown di spastina wilde-type in drosophila e zebrafish hanno portato ad anomalie nello sviluppo assonale e nella funzione sinaptica. In un modello di topo con una delezione in SPG4, che causa un codone di stop prematuro (che mima una mutazione patogenetica umana), erano stati descritti degenerazione assonale e accumulo di mitocondri in rigonfiamenti anomali vicino al cono di crescita assonale. Questi risultati potrebbero avere una correlazione umana poiché una distribuzione anormale di mitocondri, che si suppone possa essere indicativa di trasporto difettivo, era stata riportata in un reperto post-mortem di motoneuroni spinali da un individuo con HSP associata a SPG4. Fassier et al. (2003), hanno proposto studi di topo knockout per SPG4. Il vettore bersaglio per il gene Cre/LoxP era stato usato per creare topi nei quali gli esoni 5-7 della spastina erano stati deleti e sostituiti dal vettore inserito. Incrociando topi che erano eterozigoti per questa mutazione (Spdel/+) con topi transgenici CMV-Cre o con animali transgenici NSE-Cre, erano stati creati topi nei quali il gene deleto per la spastina era presente in tutti i tessuti (topi Spdel/+ / CMV-Cre) o solo nei neuroni (topi Spdel/+ / NSE-Cre). In studi preliminari alcuni topi Spdel/+ hanno mostrato un peggioramento nelle performance al rotarod paragonati con i controlli normali. Questo fenotipo è altamente variabile indicando l’importanza di altri fattori genetici. In studi non pubblicati sono stati osservati fenotipi simili nel topo knockout per SPG4 recanti una delezione eterozigote degli esoni 7 e 8 (Rainier e Fink, 2005). Osservazioni preliminari su questi animali hanno rivelato un disturbo dell’andatura età-dipendente dovuto ad un peggioramento delle abilità locomotorie degli arti posteriori. Questi deficit erano stati osservati sia nelle osservazioni in campo aperto che sul rotarod. I topi knockout per SPG4 di oltre un anno di età mostrano la tendenza a camminare con gli arti posteriori extra-ruotati e spesso hanno dimostrato peggioramento neuromotorio (del controllo del tronco, con trascinamento della coda, trascinamento del quarto posteriore) (Rainier e Fink, 2005). Paraplegina (SPG7) I topi con deficit di paraplegina sembrano evolutivamente normali alla nascita (Ferreirinha et al., 2004). Problemi motori al rotarod sono stati individuati più precocemente ai 4 mesi e continuano a progredire. Essi iniziavano a perdere peso in confronto ai controlli della nidiata a 76 

12 mesi e a 17 mesi hanno iniziato a sviluppare scoliosi e disturbo dell’andatura. Il primo cambio neuropatologico avveniva a 4 mesi nei mitocondri sinaptici. I mitocondri anomali erano ipertrofici, rigonfi e avevano creste anomale. Dagli 8 mesi si erano visti mitocondri anomali lungo tutto l’assone con segni di degenerazione mitocondriale. Nella nidiata più vecchia le disfunzioni mitocondriali erano evidenti con una riduzione nella sintesi di ATP (età >23 mesi) e una riduzione dell’attività del complesso I (età >26 mesi). Cambi alla macromorfologia dell’assone non si vedeno fin dagli 8 mesi, quando il rigonfiamento assonale veniva individuato nella materia bianca del midollo spinale. Questi fenomeni progredivano con l’età ma fino ai 15 mesi non era stata visibile una chiara degenerazioni assonale. Il rigonfiamento e la degenerazione erano stati osservati soprattutto negli assoni più lunghi del fascicolo gracile (regione cervicale) e nei funicoli laterali e anteriori (regione lombare). Rigonfiamento assonale era anche presente nei nervi ottici. Un’assonopatia progressiva interessava i nervi sciatici nella nidiata più vecchia, prima comparsa a 19 mesi. Rigonfiamenti assonali erano costituiti da accumuli di neurofilamenti e organelli, inclusi mitocondri rigonfi, facendo ipotizzare un danno a livello del trasporto assonale anterogrado. È stato dimostrato anche un danno del trasporto retrogrado in topi con deficit di paraplegina oltre i 17 mesi nei lunghi motoneuroni lombari. L’evidenza da modello di topo con deficit di paraplegina suggerisce che un deficit nella paraplegina sia causa di interruzione nella funzione mitocondriale. I topi knockout omozigoti per SPG7 hanno mostrato performance peggiori sull’apparato rotarod a partire dall’età di 6 mesi e aggravamento con l’età. L’istologia del midollo spinale ha mostrato rigonfiamento prevalente nelle colonne laterali del midollo spinale lombare, in accordo con un’assonopatia retrograda. Questo fenotipo era lentamente progressivo, con segni di degenerazione assonale che iniziano all’età di 12 mesi. Modifiche nella morfologia mitocondriale sembrano precedere modifiche assonali in questo sistema, suggerendo che la degenerazione fosse dovuta a danni nella funzione mitocondriale (Rainier e Fink, 2005). I topi con deficit di paraplegina sviluppano rigonfiamenti assonali causati da accumulo di organelli e neurofilamenti, simili a quelli visti nei topi con deficit di spastina, che precedono la degenerazione assonale e si correlano con l’esordio di danno motorio. Questo ancora una volta implica un problema di trasporto assonale che potrebbe essere secondario a disfunzione mitocondriale. Lo studio sulla proteina 2 AGF3-like (AGF3L2), metalloprotease omologa della paraplegina, che forma un supercomplesso con la paraplegina per il controllo della qualità proteica nei mitocondri, ha dimostrato che modelli di topo nullo o missense per agf3l2 avevano marcati danni nello sviluppo assonale che portavano a morte neonatale (Maltecca et a., 2008). I topi sviluppavano una grave tetraparesi ad esordio precoce ed era stato dimostrato che avevano 77 

ridotte fibre mielinizzate nel midollo spinale e una danneggiata attività del complesso I e II della catena respiratoria. Il fenotipo era più grave di quello visto nei topi con deficit di paraplegina dovuto alla più alta espressione neuronale di agf3l2, ma anche questo dimostra l’associazione della funzione mitocondriale con HSP. L’evidenza scientifica dal modello di topo per la paralegina suggerisce due possibili ipotesi su come la disfunzione mitocondriale potrebbe portare all’assonopatia retrograda che si oserva in HSP. Primo, può semplicemente esserci un deficit energetico nell’assone distale, e in particolare nella sinapsi, che causa il fallimento di molteplici processi richiesti per una sana funzione neuronale. Nel tempo la funzione sinaptica può deteriorare scatenando una graduale degenerazione assonale retrograda. Secondo, benché molti processi intracellulari ci si aspetta siano interessati da deficit dell’energia, l’effetto su uno specifico processo può essere la principale causa di degenerazione assonale. Il trasporto assonale è gravemente sconvolto nel topo con deficit di paraplegina. I lunghi assoni interessati in HSP dipendono in maniera importante dal trasporto assonale, un processo energia-dipendente, per trasportare molecole e organelli dal corpo cellulare all’assone distale su una via lunga un metro. L’identificazione del deficit del complesso I nel topo per la paraplegina può offrire una spiegazione per lo sviluppo e la progressione della malattia correlate all’età. Il complesso I è suscettibile soprattutto dei cambi correlati all’età indotti dallo stress ossidativo (Wong et al., 2002). Perciò il neurone può essere inizialmente capace di compensare la disfunzione mitocondriale causata da mutazione in paraplegina. Comunque con l’ulteriore carico aggiuntivo del deficit del complesso I correlato all’età, il meccanismo di compenso non è a lungo adeguato e avviene la neurodegenerazione. Proteolipido proteina (PLP1) Esistono modelli di topo che contengono mutazioni in PLP (jimpy(jp), jimpy-4j, msd, e rumpshaker), così come topi PLP null in cui il gene PLP è stato interrotto. E’ importante notare che il fenotipo di questi animali spesso dipende da particolari mutazioni e da “genetic background”. In base al tipo di mutazione (mutazioni missenso PLP o mutazioni da splicing aberrante dell’mRNA) si può determinare una grave ipomielinizzazione e morte precoce (16-20) o semplicemente tremore e un normale arco temporale di vita. Al contrario topi nei quali il gene PLP è stato interrotto dal “gene targeting” manifestano degenerazione assonale dipendente dalla lunghezza che è simile a quella dei pazienti con assenza di PLP. Questi studi hanno dimostrato che il “genetic background” (ad es l’impatto di geni regolatori) influenza il fenotipo della mutazione del gene PLP, le mutazioni del gene PLP possono causare o ipomielinizzazione o

78 

degenerazione assonale primaria e la degenerazione assonale in HSP può derivare da un’anomalia primaria della glia (oligodendroglia in questo caso) (Rainier e Fink, 2005). Molecola di adesione cellulare L1 (L1CAM) In un modello di topo transgenico, la perdita di L1CAM sconvolge la normale guida degli assoni corticospinali attraverso la linea mediana a livello delle piramidi. La normale decussazione alle piramidi è stimolata da molecole chemorepellenti secrete dal midollo spinale ventrale note come Sema3A (Castellani et al., 2000). L1CAM è una componente del complesso recettore Sema3A e i topi con deficit di L1CAM non rispondono a Sema3A in vitro. Mutazioni in L1CAM causano X-linked CRASH syndrome (ipoplasia del corpo calloso, ritardo, pollice addotto, paraplegia spastica e idrocefalo), MASA syndrome (ritardo mentale, afasia, andatura a passo strascicato e pollice addotto), e idrocefalo X-linked associato con la paraplegia spastica. Sono stati studiati due diversi topi L1CAM. Uno era stato prodotto inserendo un TK NEO cassette nell’esone 8 L1CAM. Questo ha prodotto una proteina L1CAM di ridotta grandezza e quantità. Inoltre i danni motori negli arti posteriori (quando cammina su o è sospeso da una griglia metallica), questi topi erano meno sensibili a stimoli nocicettivi in confronto ad animali di controllo. Studi istologici di questi topi hanno rivelato ridotta grandezza dei tratti corticospinali in confronto ai controlli. Il secondo topo knockout L1CAM era stato prodotto sostituendo gli esoni 13 e 14 di L1CAM con neomycin resistance gene cassette. Ciò ha prodotto la completa assenza della proteina L1CAM in questi animali. Questi animali hanno manifestato numerosi difetti cerebrali, inclusa la ridotta grandezza del corpo calloso e dell’ippocampo, dilatazione ventricolare, anomalie del setto, e un’anomala migrazione dei neuroni dopaminergici mesencefalici. Inoltre gli studi di mutazioni L1CAM in umani e topi hanno dimostrato che la sindrome HSP può essere cauata da disturbi dello sviluppo della formazione del tratto corticospinale piuttosto che da degenerazione del tratto corticospinale (Rainier e Fink, 2005). NIPA1 non-imprinted in Prader-Willi/Angelman syndrome region protein 1 L’introduzione di mutazioni NIPA1 umane nell’ortologo nipa1 della Caenorhabditis elegans causa neurodegenerazione. La deplezione di NIPA1 nell’ortologo di Drosophila melanogaster, la spictina, suggerisce che ha anche un ruolo nel trasporto assonale. L’ortologo di drosophila, la spictina, mostra una localizzazione preferenziale sui primi endosomi ed è stato recentemente riportato che abbia un ruolo nel mantenimento dei microtubuli e nel trasporto assonale (Wang et al., 2007). Gli studiosi hanno osservato che la spictina ha un ruolo funzionale nel segnale proteico della morfogenesi delle ossa, che porta ad una up-regolazione di diversi 79 

geni, inclusi alcuni con una potente funzione inibitoria assonale. La deplezione della spictina in drosophila si è visto porta a iperaccrescimento sinaptico alle giunzioni neuromuscolari e la proteina segnale della morfogenesi ossea anche regola l’architettura microtubulare negli assoni.

Spastizina (ZFYVE26) Mutazioni tronche nel gene ZFYVE26 che codifica per una proteina a motivo “zinco finger” con un dominio FYVE è stata recentemente scoperta. La proteina è stata chiamata spastizina e il suo mRNA è stato trovato largamente distribuito nei tessuti, con espressione simile alla spatacsina nel cervello di roditore. Iniziali studi cellulari hanno suggerito localizzazione della spastizina nel RE e negli endosomi, ancora una volta aumentando la possibilità di un ruolo nel traffico di membrana in queste posizioni. Strumpellina (KIAA0196) Mutazioni nel gene KIAA0196 che codifica la proteina strumpellina, sottendono una forma di HSP pura ad esordio in età adulta. In zebrafish knockdown della strumpellina o trasfezione con mRNA associato alla malattia porta ad assoni dei motoneuroni più corti con anomale ramificazioni quando confrontati con controlli, benché il meccanismo sottostante sia sconosciuto. CYP7B1 (SPG5A) Nel topo il knockout dell’ “X receptor alfa” nel fegato, un regolatore critico di CYP7B1 e CYP7A1, porta a degenerazione del motoneurone (Andersson et al., 2005). Il topo CYP7B1 knockout, già disponibile, dovrebbe fornire spiegazioni sulla relazione tra il difetto di CYP7B1 e il fenotipo sul motoneurone lentamente progressivo osservato nei pazienti SPG5, probabilmente dovuto a perdita di neuroprotezione da parte dei neurosteroidi prodotti dal deidroepiandrosterone da CYP7B1. SPG42 (SLC33A1) Lin et al. (2008) hanno osservato che il Knockdown del gene Slc33a1 in zebrafish esitava in un fenotipo a “coda curva”. Gli assoni dei motoneuroni spinali nel pesce mutato erano scarsi e poco organizzati in confronto al pesce wildetype. Il fenotipo veniva corretto con l’iniezione contemporanea di SLC33A1 umano wildetype, ma non con SLC33A1 mutato S113R. I risultati sono in accordo con un meccanismo di perdita di funzione.

80 

NTE (neuropathy target esterase) In topi nestin-cre:NTEfl/fl di tre settimane e in topi adulti C57BL/6J dopo dosi tossiche neuropatologiche di organofosfati è stata descritta degenerazione distale dei più lunghi assoni spinali. In entrambi i gruppi, precoci lesioni degenerative erano state seguite da rigonfiamenti contenenti accumuli di materiale assoplasmatico. Nei topi che avevano ricevuto dosi tossiche di organofosfati il massimo numero di lesioni, nei più lunghi tratti degli assoni spinali sensori, si erano ottenuti in alcuni giorni ed erano stati preceduti da un transitorio aumento di PtdCho (fosfatidilcolina) neuronale. Nei topi nestin-cre:NTEfl/fl sostenuti rialzi di PtdCho durante molti mesi erano stati accompagnati da progressiva degenerazione ed enormi rigonfiamenti degli assoni nei tratti spinali sensori e motori e da crescenti disfunzioni alle zampe posteriori. La distribuzione delle lesioni assonali strettamente assomiglia a quella osservata nella paraplegia spastica ereditaria (HSP).

81 

1.5

Forme a esordio precoce per i geni analizzati.

1.5.1 SPG3A (14q12-q21). Le mutazioni nel gene ATL1 sono responsabili di circa il 10% dei casi di HSP autosomico dominanti con un fenotipo puro ad esordio precoce. La frequenza di HSP dovute a mutazioni in ATL1 varia nei diversi studi secondo la metodologia usata dall’8 al 38%. Il fenotipo tende ad essere puro, con insorgenza durante l’infanzia con un’età media di esordio di 4,6 anni in un primo studio (Elliot, 2004), tipicamente con una progressione relativamente lenta dei sintomi, ma sono stati descritti anche fenotipi complicati da neuropatia assonale motoria e/o sensitiva (Fusco et al. 2009, Smith et al., 2009). E’ stato descritto un caso caratterizzato da fenotipo tipo Silver syndrome e mutazione in SPG4 che presenta un polimorfismo intronico già noto in SPG3A (Salameh et al., 2009). Eccezioni sono state riportate con insorgenza nella 5a e nella 6a decade in una famiglia (Sauter et al., 2004). Penetranza incompleta è stata descritta in un 80enne portatore obbligato clinicamente sano e in portatori asintomatici all’età di 62 e 25 anni (Tessa et al., 2002; D’Amico et al., 2004; Durr et al., 2004). La progressione della malattia tende ad essere lenta con solo approssimativamente un quinto degli individui che richiedono l’uso della sedia a rotelle più tardi nella vita. Le caratteristiche di HSP pura osservate in un numeroso campione studiato da Durr et al. (2004) includono piede cavo lieve (15%), diminuite pallestesie (13%) e disturbi sfinterici (25%). Gli stessi autori ipotizzano che la scoliosi sia presente in un quinto dei casi per la più precoce età d’esordio del fenotipo in confronto ad altre forme di HSP. Inizialmente è sembrato che le mutazioni in SPG3A fossero limitata a cambi missenso in diversi hotspots. Un crescente numero di mutazioni sono state identificate disseminate lungo tutto il gene con cambi missenso riportati negli esoni 4, 7, 8, 9, 12 e 13. In seguito sono state identificate inserzione che causano frameshift e la prematura interruzione della proteina (Tessa et al., 2002, Ivanova et al., 2007; Louriero et al., 2009). Non sono stati riportati riarrangiamenti ancora in questo gene eccetto una piccola delezione in-frame (Meijer et al., 2007) e una singola delezione dell’intero gene che è stata trovata non segregare con la malattia o modificare il fenotipo dei pazienti affetti (Beetz et al., 2007). Il mappaggio di SPG3A e l’individuazione del gene: In una su tre famiglie studiate, Hazan et al. (1993) avevano trovato valori di linkage significativi con un gruppo di marcatori sul cromosoma 14q, con un massimo multipoint lod score pari a 10. Nelle altre due famiglie lo stesso locus era stato escluso.

82 

Gispert et al. (1995) avevano descritto 3 ampi pedigrees Tedeschi con paraplegia familiare spastica autosomica dominante pura. Uno dei tre era stato dimostrato in linkage con una regione di 7 cM sul cromosoma 14q. Su 33 famiglie SPG studiate da Fink et al. (1996) il linkage al locus 2p era il più comune, essendo positivo in 15 famiglie (45%), due erano in linkage con il locus 14q (6%) e in una con il locus 15q (3%). Huang et al. (1997) hanno mappato una paraparesi spastica autosomica dominante in una famiglia nel Nord del Tibet usando marcatori microsatellitari al locus 14q11.2-q24.3. In tutti gli individui affetti nella famiglia Tibetana i segni di spasticità erano limitati alle gambe, gli individui più giovani mostravano un Babiski positivo. Zhao et al. (2001) hanno analizzato 5 famiglie con paraplegia spastica autosomica dominante che erano risultate in linkage con il locus SPG3A sul cromosoma 14 (14q). Lo stesso gruppo ha identificato un individuo ricombinante obbligato, che ha permesso di ridurre l’intervallo contenente il locus SPG3A a 2.7 cM, e di analizzare i geni candidati in questo intervallo per mutazioni causative di malattia (Rainier et al., 2001). Nel lavoro di Zhao et al. (2001) è indicata l’identificazione di una mutazione missenso specifica per la malattia presente in tutti gli individui affetti dalle 5 famiglie in un nuovo gene HSP, chiamato appunto SPG3A, che hanno mappato sul cromosoma 14q11-q21l. Zhu et al. (2003) hanno stabilito il mappaggio al cromosoma 14q22.1, per primi hanno clonato SPG3A, che hanno chiamato atlastina-1. Il gene codifica una proteina di 558 amminoacidi, che forma omotetrameri ed ha attività GTPasica (si veda paragrafo 1.4.1). Abel et al. (2004) hanno identificato le mutazioni nelle famiglie descritte nei primi studi da Hazan et al. (1993) e da Gispert et al. (1995). Tabella 1.5. Mutazioni note nel gene SPG3A. Zhao et al. (2001) identificano il cambio nucleotidico in eterozigosi c.884 C>T (2) nell’esone 7. R239C

S259Y H258R R217Q D508fsX522 M408V R415W A161P 83 

Abel et al. (2004) identificano la stessa mutazione R239C ma riportano il cambio al nucleotide c.715C>T (1) basata sulla numerazione dal codone iniziale di traduzione. Namekawa et al. (2006) confermano che la mutazione cade in un “hotspot” definito da un dinucleotide CpG metilato. Zhao et al. (2001) identificano il cambio nucleotidico nel cDNA in eterozigosi 776C>A (1) nell’esone 8 Zhao et al. (2001) trovano il cambio al nucleotide c. 773A>G (1) solo nei pazienti affetti

Muglia et al. (2002) identificano il cambio nucleotidico 818G>A (2), in un motivo altamente conservato, c.650G>A (1) Tessa et al. (2002) identificano un’inserzione di 1-bp nell’esone 12, che produce un frameshift e un codone di stop prematuro, c.1520-1521insA (1) Dal Pozzo et al. (2003) identificano il cambio 1222 A>G (1) nell’esone 12. (Nel databese OMIM è indicata come una SNP, ma non sono indicati i dati di frequenza di popolazione) D’Amico et al. (2004) trovano la stessa mutazione c.1243 C>T (1)nell’esone 12 in 3 membri affetti della stessa famiglia ma è anche presente in 9 parenti asintomatici di età variabile tra 13 e 70 anni Sauter et al. (2004) nell’esone 4, cambio nucleotidico c.481G>C (1) questa mutazione è presente anche in una famiglia con esordio tardivo

H247P

Sauter et al. (2004) nell’esone 8, cambio nucleotidico c.740A>C (1)

F151S

Abel et al. (2004) cambio nucleotidico c.452T>C (1)

I315S

Abel et al. (2004) cambio nucleotidico c.944T>G (1)

S398Y

Abel et al. (2004) cambio nucleotidico c.1193C>A (1)

Q251K

Durr et al. (2004), cambio nucleotidico c.919C>A (2), cambio nucleotidico c.751A>C (1) esone 8

V2531

Durre t al. (2004) cambio nucleotidico c.925G>A (2), c.757G>A (1) esone 8

S398Y

Durre t al. (2004) cambio nucleotidico c.1361C>A (2), esone 12

F413L

Durr et al. (2004) cambio nucleotidico c.1405T>C (2), cambio nucleotidico c.1237T>C (1) esone 12

N440T

Durr et al. (2004) cambio nucleotidico c.1487A>C (2), 1319A>C (1), esone 12

R495W

Durr et al. (2004) cambio nucleotidico c.1651C>T (2), 1483C>T (1), esone 12

S519N

Durr et al. (2004) cambio nucleotidico c.1724G>A (2), c.1556G>A (1), esone 13

T156I

Hedera et al. (2004) cambio nucleotidico c.635 C>T (2), c.467 C>T (1)

T162P

Namekawa et al. (2006) cambio nucleotidico c.484A>C (1)

C375R

Namekawa et al. (2006) cambio nucleotidico c.1123T>C (1)

L157W

Rainier et al. (2006) identificano il cambio nucleotidico c.638T>C nell’esone 4

Delezione del Beetz et al. (2007) hanno identificato nella stessa famiglia la delezione patogenetica dell’esone 1 in gene SPG3A SPG4 e la delezione dell’intero gene SPG3A Ivanova et al. (2007) cambio nucleotidico c.572A>G, esone 5 Q191R L250P

Ivanova et al. (2007) cambio nucleotidico c.749T>C, esone 8

Y336H

Ivanova et al. (2007) cambio nucleotidico c.1006C>T, esone 10

M408T

Ivanova et al. (2007) cambio nucleotidico c.1223T>C, esone 12

G469A

Ivanova et al. (2007) cambio nucleotidico c.1406G>C, esone 12

G482V

Ivanova et al. (2007) cambio nucleotidico c.1445G>T, esone 12

A492fsX522

Ivanova et al. (2007) inserzione nucleotidica c.1474_1475insG, esone 12

Y459C

Matsui et al. (2007) cambio nucleotidico c.1376A>G, esone12

436delN

Meijer et al. (2007) identificano una delezione di 3-bp

R416H

De Leva et al. (2009) cambio nucleotidico c.1247G>A, esone 12

E502fsX522

Louriero et al. (2009) inserzione nucleotidica c.1504_1505insG, esone 12

A165T

Smith et al. (2009) cambio nucleotidico c.493G>A, esone 4

R239L

Smith et al. (2009) cambio nucleotidico c.716G>T, esone 7

H247R

Smith et al. (2009) cambio nucleotidico c.740A>G, esone 8

S259F

Smith et al. (2009) cambio nucleotidico c.776C>T, esone 8

S398F

Fusco et al. (2009) cambio nucleotidico c. 1361, esone 12

(1) - La nomenclatura approvata conta +1 all’A della Metionina del codone d’inizio. GenBank Reference AY032844.1. (2) - La numerazione tradizionale per le mutazioni in SPG3A parte da +1 dall’inizio del trascritto, usata da alcuni autori prima del 2004.

84 

1.5.2 SPG5A (8q21.3). Questa forma autosomica recessiva è associata a fenotipi puri e complessi con età variabile di esordio, prevalentemente adolescenti e giovani adulti, e lenta progressione. In uno studio di linkage era stato ipotizzato rappresentasse il 10% delle ARHSPs (Klebe et al., 2007). Hentati e collaboratori (1994) hanno riportato per primi, in seguito ad uno studio effettuato su 5 famiglie tunisine affette da una forma pura di HSP, analisi di linkage positive in 4 famiglie, per una regione di 32.2 cM contenente due dei loci che erano stati messi in linkage, mappati al cromosoma 8p12 e 8cen-q13, rispettivamente. Hentati et al. (1994) diedero alla regione pericentrica del cromosoma 8 la possibile localizzazione per il locus SPG5A. Wilkinson et al. (2003) hanno rifinito il locus ad un intervallo di 23.6 cM sul cromosoma 8q11.1-q21.2. Klebe et al. (2007) hanno rifinito il locus a 3.8 cM, un intervallo di 5.9 Mb. Tsaousidou et al. (2008) hanno identificato il gene responsabile per SPG5, una forma pura di paraplegia spastica autosomica recessiva. Mutazioni missenso e non-senso sono state trovate nel gene CYP7B1 in cinque famiglie. CYP7B1 è un membro della superfamiglia delle citocromo P450 di monoossigenasi, coinvolte nel metabolismo del colesterolo, dei neurosteroidi e di altri lipidi. Nel fegato CYP7B1 offre un pathway alternativo per la degradazione del colesterolo e inoltre fornisce la via metabolica principale per la modificazione del neurosteroide deidroepiandrosterone nel cervello. Le mutazioni in CYP7B1 si pensa interessino l’omeostasi del colesterolo che è una componente vitale delle cellule neuronali, in particolare della mielina. E’ possibile che anomalie nel metabolismo del colesterolo possano influire sullo sviluppo precoce degli assoni (CYP7B1 è associato con HSP ad esordio precoce) prima che sulla degenerazione, in maniera simile a quella vista nelle HSP associate a PLP1. Le mutazioni missenso sono alterano la fosforilazione della proteina; le mutazioni non senso risultano in una perdita di funzione (Tsaousidou et al., 2008). Goizet et al., (2009) hanno studiato un’ampia casistica di 82 casi ARHSP con fenotipo puro e complesso e 90 casi sporadici di HSP pura, identificando 8 mutazioni in CYP7B1 in 9 famiglie. L’età media dei pazienti all’esordio è 16±12.1 anni (range 4-47 anni). Dopo una lunga durata di malattia (media 30 anni) la spasticità e il grado di disabilità sono da medio a grave in tutti i casi. Il fenotipo è puro in 7 famiglie SPG5 e complesso in 2 famiglie, con segni cerebellari e neuropatia periferica. La frequenza di mutazioni in CYP7B1 nello studio di Goizet et al. (2009) è di 7.3% nelle famiglie ARHSP e 3.3% tra i casi sporadici.

85 

Tabella 1.6. Mutazioni note nel gene SPG5A. Tsaousidou et al. (2008) identificano il cambio nucleotidico in omozogosi c.1162C>T in un paziente R388X S363F G57R R417H F216S Y275X

sporadico Tsaousidou et al. (2008) identificano il cambio nucleotidico in omozogosi c.1088C>T nell’esone 5 nei membri affetti dell’ampia famiglia consanguinea Inglese descritta da Wilkinson et al. (2003) negli studi di linkage Tsaousidou et al. (2008) identificano il cambio nucleotidico in omozogosi c.169G>A nell’esone 2 nei membri affetti di una famiglia Tunisina descritta da Hentati et al. (1994) negli studi di linkage Tsaousidou et al. (2008) identificano il cambio nucleotidico in omozogosi c.1250G>A nell’esone 6 nei membri affetti di due famiglie Tunisine descritte da Hentati et al. (1994) negli studi di linkage, Goizet et al. (2009), lo stesso cambio nucleotidico, in omozigosi e in eterozigosi Tsaousidou et al. (2008) identificano il cambio nucleotidico in omozigosi c.647T>C nell’esone 3

A394D

Schule et al. (2009) identificano il cambio nucleotidico in omozigosi c.825T>A in una paziente sporadica che a 18 aveva presentato atrofia ottica Schule et al. (2009) identificano il cambio nucleotidico in eterozigosi c.1181C>A, nell’esone 5

N105KfsX3

Schule et al. (2009) identificano l’inserzione nucleotidica in eterozogosi c.308_309insA, nell’esone3

G21fsX47

Biancheri et al. (2009) identificano una delezione in eterozigosi a livello c.66delC che porta ad un codone di stop prematuro, nello stesso paziente la variante c.122+19 A>T in silico porterebbe ad una alterazione dello spicing Criscuolo et al. (2009) identificano in omozigosi l’inserzione c.1362insT nell’esone 6

A453CfsX470

D269VfsX282 Criscuolo et al. (2009) identificano in omozigosi la delezione c.806delA nell’esone 3 R112X

Goizet et al. (2009), mutazione non senso c.334 C>T, in esone 2, in omozigosi

Y275X

Goizet et al. (2009), mutazione non senso c.825 T>A, in esone 3, in omozigosi

R417C

Goizet et al. (2009), cambio nucleotidico c.1249 C>T, in esone 6, in omozigosi

F470I

Goizet et al. (2009), cambio nucleotidico c.1408 T>A, in esone 6, in eterozigosi

R486C

Goizet et al. (2009), cambio nucleotidico c.1456 C>T, in esone 6, in omozigosi

R63X

Goizet et al. (2009), mutazione non senso c.187 C>T, in esone 2, in eterozigosi

T297A

Goizet et al. (2009), cambio nucleotidico c.889 A>G, in esone 4, in omozigosi e in eterozigosi

86 

1.5.3 SPG42 (3q25.31). Questa forma di HSP pura autosomica dominante è stata riportata da Lin et al. (2008) in una ampia famiglia Cinese, in cui almeno 20 individui sono stati diagnosticati. È descritta penetranza incompleta in un portatore obbligato, un paziente asintomatico di 43 anni con una figlia che ha avuto esordio di malattia a 8 anni. L’età di esordio è variabile, spaziando tra 4 e 42 anni, ma la maggior parte degli individui affetti manifesta i primi sintomi nelle prime due decadi di vita. Le caratteristiche cliniche includono andatura spastica, aumento del tono agli arti inferiori, iperiflessia, ipostenia e atrofia ai muscoli degli arti inferiori, risposte in estensione plantare, e piede cavo. Nessuno dei pazienti è diventato dipendente da sedia a rotelle, non ci sono segni neurologici aggiuntivi. Gli studi elettromiografici, di neuroimmagini e di biopsia muscolare non hanno rivelato anomalie. Gli autori hanno effettuato inizialmente uno studio di linkage per ciascuno dei loci noti di ADHSP, in base al quale tutti sono stati esclusi. Successivamente è stato effettuato lo studio sull’intero genoma, usando 205 marcatori microsatellitari, con una distanza media di 15-20 cM. Tra questi 6 hanno prodotto un “LOD score” positivo, di cui solo 2 mappati sul cromosoma 3q, mentra gli altri 4 sui cromosomi 4, 6, 7 e 20. Con ulteriori microsatelliti a più alta densità questi sono stati esclusi. Mentre 7 ulteriori marcatori sul cromosoma 3q hanno dato “LOD score” significativo >3. L’analisi di linkage “multipoint” con l’uso di 11 marcatori sul cromosoma 3q ha dato un picco di “LOD score” tra i marcatori D3S2326 e D3S3053, questo intervallo di 22 cM corrisponde ad una distanza fisica di 27.54 Mb. Un totale di 130 trascritti mappano all’interno di questa regione, nessuno dei quali poteva essere un buon candidato per la malattia. Sulla base della loro espressione nei neuroni gli autori hanno selezionato un gruppo di geni per l’analisi mutazionale. Nei membri affetti della famiglia, Lin et al. (2008) hanno identificato in eterozigosi un cambio nucleotidico c.339T>G nell’esone 1 del gene SLC33A1, che produce un cambio aminoacidico ser113-arg (S113R) all’inizio del secondo dominio trans membrana. Tramite analisi in silico per la predizione dei domini transmembrana (SOSUI) questo cambio aminoacidico è atteso invertire l’orientamento di tutti i domini successivi. Il residuo 113 è altamente conservato, e la mutazione non era presente in 200 controllo. Lin et al. (2008) hanno ipotizzato un meccanismo di aploinsufficienza funzionale.

87 

Capitolo 2 – OBIETTIVI Scopo di questa tesi, svolta presso il laboratorio di Neurogenetica del CERC-Fondazione Santa Lucia di Roma, è stato quello di effettuare un’indagine molecolare su casi apparentemente sporadici e familiari affetti da forme ad esordio precoce di HSP. La scelta del campione è stata effettuata sulla base dei dati anamnestici su pazienti afferenti presso il Dipartimento di Neuroscienze del Policlinico Universitario “Tor Vergata” di Roma. Le affezioni neurodegenerative ad esordio in età pediatrica in precedenza sono state spesso definite solo sulla base del quadro neuropatologico e per la mancanza di un marker biochimico riconoscibile. Grazie all’individuazione del locus genico associato alla malattia o meglio, quando noti, alla natura dei geni coinvolti, sono state dimostrate nella maggior parte dei casi patologie in cui sono alterate proteine a funzione enzimatica o a carattere strutturale, il cui risultato finale è un’alterazione dell’omeostasi cellulare che porta ad apoptosi e precoce impoverimento tissutale. Nel loro complesso queste patologie, singolarmente rare o rarissime, costituiscono nei paesi occidentali, una delle cause più frequenti di disturbo dello sviluppo e del funzionamento del sistema nervoso centrale (SNC) in età pediatrica. La diagnosi richiede spesso procedure complesse non alla portata di tutti i laboratori. La discrepanza tra il costo della diagnosi e l’utilità di questa sul piano terapeutico (modesto o nullo) ha in passato giustificato uno scarso accanimento diagnostico in queste malattie. Nel corso degli ultimi 20 anni con lo sviluppo di sempre più sofisticate tecnologie nel campo della neurogenetica, delle neuroimmagini e dell’analisi metabolica nei tessuti e nei liquidi biologici sono state descritte nuove entità cliniche ed è stato svelato il meccanismo etiopatogenetico di molte affezioni già note. La diagnosi differenziale tra malattie neurodegenerative come le paraparesi spastiche ereditarie (HSPs), oggetto di questo studio di tesi, che esordiscono con disturbi del movimento in età pediatrica e soprattutto nella primissima infanzia non è sempre facile, soprattutto nei confronti delle diverse forme di paralisi cerebrali infantili (PCI) che costituiscono una diagnosi frequente in questa fascia d’età (spesso con etiologia presuntiva). L’emergenza di una patologia lesionale che comprometta lo sviluppo motorio, determinando un deficit di diversa estensione e gravità, si sovrappone ai rapidi fenomeni neuromaturazionali che caratterizzano i primi anni di vita.

88 

L’evoluzione del quadro clinico più o meno rapidamente può chiarire la patologia sottostante, il problema della diagnosi differenziale ha invece un’importanza rilevante in un numero crescente di affezioni che consentono un intervento terapeutico, spesso specifico ed efficace (se precoce). Nel caso specifico di patologie neurodegenerative come le HSPs è da sottolineare la responsabilità clinica nell’informare la famiglia della natura genetica di una affezione e del rischio che questa possa ripetersi in una ulteriore gravidanza. I risultati degli esami genetici possono essere applicati alla diagnosi prenatale. Malgrado gli sviluppi negli esami genetici nelle HSPs, la HSP è una diagnosi di esclusione per molti soggetti. La diagnosi differenziale include i disturbi trattabili così come quelli la cui prognosi è completamente differente. Attualmente, il trattamento per HSP è sintomatico e include terapia fisica riabilitativa e l’uso di farmaci che riducono la spasticità e l’urgenza urinaria. Studi clinici e genetico-molecolari dei geni e delle funzioni cellulari dei corrispettivi prodotti hanno permesso di avanzare nella comprensione di molti pathways critici coinvolti nella HSP. E’ auspicabile che in futuro queste conoscenze cominceranno a tradursi in nuovi approcci farmacologici per questa malattia neurodegenerativa. Come si è tentato di illustrare nel primo capitolo (Tab. 1a e Tab. 2a) le forme ad esordio precoce costituiscono oltre il 50% di tutte le HSP. Per quanto riguarda le forme autosomiche dominanti su 9 geni noti ADHSP 6 sono forme “early onset”, mentre per quanto riguarda le 10 forme ADHSP di cui sono noti solo i loci, 6 sono “early onset”. Di 22 forme autosomiche recessive 8 geni ARHSP sono noti di cui 6 “early onset”, mentre delle 14 forme di cui sono noti solo i loci, 9 sono “early onset”. Le HSP X-linked sono tutte forme “early onset”. Una prima parte del lavoro ha previsto uno studio di linkage a due punti per ciascuno dei loci noti per una famiglia informativa che presentava una forma ad esordio precoce di ADHSP con caratteristiche cliniche peculiari ai fini di effettuare un mappaggio di esclusione (paragrafo 3.2.2) per i loci noti. Le famiglie ADHSP con forme ad esordio precoce i cui dati sono risultati negativi dall’analisi di linkage e alcuni casi apparentemente sporadici sono stati esaminati per il gene SPG3A, al fine di identificare mutazioni in uno dei primi geni identificati e causa più frequente (10%) di forme autosomiche dominanti “early onset”. Quindi i casi sporadici negativi per SPG3A e ulteriori casi ARHSP che avevano manifestato esordio precoce dei sintomi sono stati esaminati per il gene SPG5A, per poter identificare mutazioni in uno dei geni identificati per le forme autosomiche recessive con più

89 

alta prevalenza (7.3% nelle famiglie ARHSP e 3.3% tra i casi sporadici) in forme pure e complesse con età variabile di esordio, prevalentemente in adolescenza e giovane età adulta. I casi autosomico dominanti negativi per SPG3A sono stati sottoposti successivamente ad ulteriori analisi per un altro gene recentemente associato a paraplegia spastica ereditaria, SPG42, la cui prevalenza non è nota poiché per ora noto solo in una famiglia (Lin et al., 2008). I casi familiari autosomici dominanti e quelli apparentemente sporadici negativi alle precedenti indagini molecolari e ritenuti possibili candidati sono stati sottoposti alla metodologia recentemente applicata MLPA per individuare eventuali riarrangiamenti nel gene SPG3A, che non fosse stato possibile identificare con la metodica tradizionale del sequenziamento diretto, specifica per mutazioni puntiformi. Tutti i casi autosomico dominanti erano stati sottoposti in prima istanza all’indagine molecolare per SPG4 non per la specificità di questa forma nei casi ad esordio precoce, ma piuttosto sulla base della elevata prevalenza su tutte le forme ADHSP (circa 40-45% dei casi) ed erano risultati negativi. 

90 

Capitolo 3 – MATERIALI E METODI 3.1 Pazienti Sono stati selezionati 30 soggetti affetti da forme di paraparesi spastica ad esordio in età pediatrica di cui la maggior parte tra i pazienti afferiti presso il Dipartimento di Neuroscienze del Policlinico Universitario “Tor Vergata” di Roma negli anni 2004 – 2008, e per il resto campioni pervenuti al nostro laboratorio attraverso collaborazioni con altri centri italiani e internazionali. Lo studio clinico dei pazienti è stato effettuato seguendo i protocolli etici previsti e approvati dal comitato etico dell’Istituto di Ricovero e Cura a Carattere Scientifico Santa Lucia di Roma. I campioni di sangue sono stati prelevati in seguito al consenso informato per l’estrazione del DNA. I campioni di DNA estratti da due pazienti apparentemente sporadici Giapponesi provengono da una collaborazione con un Centro per la Ricerca in Malattie Neurodegenerative in Canada (Centre for Research in Neurodegenerative Diseases, University of Toronto, Toronto, Ontario, Canada) e con un Dipartimento di Neurologia in Giappone (Department of Neurology, Hyogo Brain and Heart Center, Himeji City, Japan). I campioni di sangue prelevati da sette campioni di pazienti affetti da HSP familiari e sporadiche provengono da altre collaborazioni con Centri di Ricerca e Università Italiane (Udine, Bologna, Sassari, Cagliari, Napoli, Roma, Cefalù, Firenze). I criteri di inclusione sono stati: -

obiettività neurologica compatibile con diagnosi di HSP

-

età di esordio in infanzia ed adolescenza (cut-off 20 anni)

-

studio neurofisiopatologico compatibile con diagnosi di HSP

-

studio di neuroimmagini compatibile con diagnosi di HSP

-

indagini di laboratorio negative per altre patologie.

Descrizione del campione:

91 

-

12 famiglie: 9 con ADHSP, 3 con ARHSP

-

18 casi apparentemente sporadici

-

età: range all’esordio "+$)*$"*(%7(&)*+);+'%)@"#+'%"#"*(+&*+7*+RG8=S+%" >[email protected]%&A(&)*+ %"7$(&)*+ 7%"+ #C;;&$&"*(+ ()+ 766)3+ 765 (7%9"(+#"BC"*$"#+()+(>"+$)%%"#')*A&*9+'%)@"+)6&9)* %"7$(&)*/+ 7''%)U&57("6?+ .2242224222+ $)'&"#+ );+ "7 '%"#"*(/+3>&6"+(>"%"+7%"+ )*6?+-24222+ $)'&"#+ );+5)# >C57*+ !D=+ #75'6"4+ 8%)6)*9&*9+ (>"+ >[email protected]%&A(&)*+ '%)@"#+ 3&66+ *)(+ &*;6C"*$"+ (>"+ %"#C6(#+ )@(7&*"A/+ 5 %)@C#(4++ + =#+#7&A/+'%)@"+5)6"$C6"#+(>7(+A)+*)(+;&*A+7+(7%9"(+# "U')*"*(&766?+ 75'6&;&"A/+ 7*A+ 3&66+ (>C#+ *)(+ 9"*"%7 %"#C6(/+ (>"+ %"67(&,"+ #&9*76+ #(%"*9(>+ );+ "7$>+ 75'6&; '%&57%&6?+ @?+ (>"+ $)'?+ *[email protected]"%+ );+ (>"+ (7%9"(+ #"BC "U$"##+ RG8=5+ '%)@"#+ A)+ *)(+ >7,"+ ()+ @"+ %"5)," %"7$(&)*+&#+"U(%"5"6?+#&5'6"4+ +

12345'9%.+.6.,' M4 -4 + :4 + N4 .4 +

!D=+A"*7(C%7(&)*X+>"7(+.+5&*C("#+7(+0O+YH4+ [email protected]%&A&E7(&)*X+7AA+[=G[=+'%)@"5&U+7*[email protected] T*[email protected]("+M+5&*C("+7(+0.+YH/+>[email protected]%&A&E"+;)%+M%+ G&97(&)*X+7AA+6&97#"+5&U+7*A+&*[email protected]("+M.+5&*C(" Z"7(+&*7$(&,7("+(>"+6&97#"+;)%+.+5&*C("#+7(+0O+YH =AA+'%&5"%#/+ADQ8#+7*A+')6?5"%7#"+7*A+#(7%(+8 H7'&667%?+"6"$(%)'>)%"#&#X+"U')%(+;%795"*(+6"*9( #);(37%"+)%+#'%"7A#>""(4+=*76?E"+%"#C6(#4+

4:;"+ #75'6"+ !D=/+ (>"+ '%)@"+ )6&9)*C$6")(&A"#+ 7%"+ "*E?57(&$766?+ 6&97("A4+ F*"+ '%)@"+ )6&9)*C$6")(&A"+ $)*(7&*#+ 7+ *)*1>[email protected]%&A&#&*9+ #(C;;"%+ #"BC"*$"+ );+ ,7%[email protected]"+ 6"*9(>4+ G&97(&)*+ '%)AC$(#+ $7*+ @"+ 75'6&;&"A+ C#&*9+ 8HI+ '%&5"%+ #"BC"*$"#+ J+ 7*A+ K+ 75'6&;&$7(&)*+ '%)AC$(+ );+ "7$>+ '%)@"+ >7#+ 7+ C*&BC"+ 6"*9(>+ LM:21NO2+ *(P4+ =5'6&;&$7(&)*+ '%)AC$(#+ 7%"+ #"'7%7("A+ @?+ "6"$(%)'>)%"#+ I"67(&,"+ 75)C*(#+ );+ '%)@"+ 75'6&;&$7(&)*+ '%)AC$(#/+ 7#+ $)5'7%"A+ ()+ 7+ %";"%"*$"+ !D=+ #75'6"/+ %";6"$(+ (>"+ %"67(&,"+ $)'?+ *[email protected]"%+ );+ (7%9"(+ #"BC"*$"#4++

Figura 3.2. I passaggi principali della reazione MLPA.

333456'74$)5+

:4 N4 .4

Q>"+ RG8=S+ ("$>*&BC"+ $7*+ @"+ C#"A+ ;)%+ 57*?+ A A&;;"%"*$"[email protected]"(3""*+A&;;"%"*(+7##7?#+&#+(>"+'%)@" RG8=S+ &#+ 5C6(&'6"UX+ )*"+ %"7$(&)*+ '%),&A"#+ &*;) ])%+5)#(+7''6&$7(&)*#/+(>&#+&#+#C;;&$&"*(+()+7*#3" @?+7+'>?#&$&7*4+ RG8=S+ %"7$(&)*#+ 7%"+ $)#(+ ";;"$(&,"X+ (>"+ '%&$ %"7$(&)*#+ &#+ ^+ MM224+ Q>&#+ &*$6CA"#+ 766+ %"79"* ')6?5"%7#"/+ADQ8#+7*[email protected]"66"A+8HI+'%&5"%#P4+ RG8=S+ &#+ %"'%)[email protected]"+ 7*A+ "7#?+ ()+ '"%;)%5/+ 7 $7*[email protected]"+("#("A+#&5C6(7*")C#6?4+ RG8=S+&#+#"*#&(&,"X+)*6?+-2+*9+);+>C57*+!D=+ A"'"*A+)*+(>"+75)C*(+);+#75'6"+!D=+C#"A4+

106 

Durante il primo passaggio il DNA è denaturato e messo in incubazione durante la notte con una miscela di sonde MLPA. Ciascun oligonucleotide sonda è complementare ad una data sequenza bersaglio ed è costituita di due parti: contiene una sequenza non ibridizzante di lunghezza variabile (“stuffer sequence”) differente per ciascuna sonda e una sequenza di primer per PCR. I due oligonucleotidi sonda ibridizzano alle sequenze target immediatamente adiacenti. Solo quando i due oligonucleotidi sonda ibridizzano, le due emi-sonde possono essere ligate durante la reazione di ligazione da uno specifico enzima ligasi. La reazione di ligazione è così specifica che è in grado di distinguere sequenze che differiscono in un singolo nucleotide. I prodotti della ligazione contengono entrambe le sequenze di primer per la PCR in ogni frammento e quindi saranno amplificate esponenzialmente durante la reazione di PCR. Al contrario gli oligonucleotidi sonda che non sono stati ligati contengono solo una sequenza di primer e di conseguenza, le emi-sonde non ligate non saranno amplificate esponenzialmente e non genereranno un segnale. La rimozione delle sonde non legate è perciò non necessaria in MLPA. Poiché solo le sonde ligate saranno esponenzialmente amplificate durante la successiva reazione di PCR, il numero dei prodotti è una misura del numero delle sequenze bersaglio nel campione, in un grafico che ha in ascissa il range di grandezza in nucleotidi (da 120-480 nt), nel nostro caso gli esoni, e in ordinata il segnale di fluorescenza, che esprime l’area del picco, indice della quantità di prodotto. Ci sarà sempre qualche sequenza la cui quota di amplificazione per ciclo sarà dell’1-2% inferiore alle altre, dando luogo ad un’area di picco finale più bassa. Un singolo profilo di amplificazione MLPA non è sufficiente per determinare se ci siano dei cambiamenti nel numero di copie: ogni profilo di picco dovrà sempre essere confrontato con quello di un campione di riferimento. Confrontato a questo campione di riferimento, la relativa area del picco di ciascun prodotto di amplificazione allora riflette il relativo numero di copie della sequenza bersaglio della sonda nel campione di pazienti analizzato. Una delezione di uno o più esoni in un paziente diventa evidente come diminuzione nella relativa area del picco dei prodotti di amplificazione delle sonde corrispondenti a questi esoni. La concentrazione di sonde presenti in una reazione MLPA e la durata della reazione di ibridazione sono sufficienti per consentire la quasi completa ibridizzazione delle sequenze bersaglio ai corrispondenti oligonucleotidi sonda. In una tipica reazione MLPA circa 500.000.000 copie di ciascun oligonucleotide sonda sono presenti, mentre ci sono solo 20.000 copie della maggior parte delle sequenze bersaglio in un campione di 60 ng di DNA umano. Il 107 

prolungando della reazione di ibridizzazione o l’aggiunta di più sonde non influenza il risultato ottenuto, rendendo la reazione estremamente affidabile. Le molecole sonda che non trovano una sequenza bersaglio non saranno ligate e di conseguenza tantomeno amplificate esponenzialmente, perciò non sarà generato il corrispettivo segnale di fluorescenza. La forza del corrispettivo segnale di ciascun prodotto di amplificazione è determinata soprattutto dal numero di copie della sequenza bersaglio nel campione. Poiché non bisogna rimuovere l’eccesso di sonde MLPA, il protocollo per ogni reazione è abbastanza pratico. Protocollo MLPA: 1. Denaturazione del DNA: 5 minuti a 98°C. 2. Ibridizzazione: aggiungere la miscela di sonde SALSA e il buffer MLPA. Mettere in incubazione per 1 minuto a 95°C, lasciare ibridizzare per 16 ore a 60°C. 3. Ligazione: aggiungere la miscela di ligasi e lasciare incubare per 15 minuti a 54°C. Inattivare con il calore la ligasi per 5 minuti a 98°C. 4. Aggiungere i primers, dNTPs e polimerasi e dare inizio alla PCR. 5. Elettroforesi capillare. Successivamente vengono esportare le lunghezze dei frammenti e le aree dei picchi. I dati ottenuti vengono analizzati con il software COFFALYSER v.9.4. Esistono degli svantaggi con l’utilizzo di questa tecnica legati soprattutto alla limitata specificità. Il metodo identifica principalmente delezioni/inserzioni e non è utile per individuare mutazioni puntiformi non note, una mutazione o un polimorfismo nella sequenza ibridizzata dalla sonda può anche causare una riduzione nella relativa area del picco. Inoltre le reazioni sono più sensibili a contaminanti (come inibitori della PCR) rispetto a reazioni di PCR ordinarie e lo sviluppo di miscele di sonde SALSA MLPA è limitato dai costi e dai tempi che richiede.

108 

3.3 Analisi dei dati Database e software utilizzati: HUGO : http://www.genenames.org/ NCBI : http://www.ncbi.nlm.nih.gov HGMD The Human Gene Mutation Database http://www.hgmd.cf.ac.uk/ac/index.php HGVS The Human Genome Variation Society http://www.hgvs.org/mutnomen/ LINKAGE User's Guide, version 5.2 (May 31, 1993), pacchetto di software LINKAGE: http://linkage.rockefeller.edu/soft/linkage/right.html Rockefeller University, Lab of Statistical Genetics : http://www.rockefeller.edu/ CEPH, Fondation Jean Dausset, Human Plymorphism Study Center: http://www.cephb.fr/ MRC-Holland-MLPA : http://www.mlpa.com/ Applied Biosystem : http://www3.appliedbiosystems.com/AB_Home/index.htm REBASER The Restriction Enzyme Database http://rebase.neb.com/rebase/rebase.html NEB cutter scelta degli enzimi di restrizione http://tools.neb.com/NEBcutter2/index.php ENSEMBL scelta dei microsatelliti: http://www.ensembl.org/index.html SOSUI: predizione domini transmembrana delle proteine http://bp.nuap.nagoya‐ u.ac.jp/sosui/sosui_submit.html ExPasy, database di proteine: http://www.expasy.ch/ NetPhos v.2.0, predizione sito di fosforilazione http://www.cbs.dtu.dk/services/NetPhos/ Polyphen predizione di effetto funzionale delle nsSNPs umane: http://genetics.bwh.harvard.edu/pph/ Fruitfly, predizione sito di splicing : http://www.fruitfly.org/seq_tools/splice.html Saccharomyces Genome Database: disegno primers: http://www.yeastgenome.org/ ClustalW : allineamento multiplo sequenze: http://www.ebi.ac.uk/Tools/clustalw2/index.html

109 

Cyrillic v. 2.1.2: disegno alberi genealogici SeqScape v. 2.5: allineamento sequenze Sequencing Analysis v. 5.2: visualizzazione elettroferogrammi Gene mapper V.4.0: analisi dei microsatelliti SLINK, MLINK: analisi di linkage Coffalyser V.9.4: software per l’analisi dei dati MLPA

110 

Capitolo 4 – RISULTATI 4.1 Analisi del gene SPG3A Una prima parte del lavoro ha previsto uno studio di linkage a due punti per ciascuno dei loci noti per una famiglia italiana con ADHSP, RMFSL200, in cui 8 membri in 4 generazioni sono affetti. E’ stata effettuata un’analisi genetica di linkage tramite microsatelliti.

Fig. 4.1. Pedigree della famiglia RM150.

La famiglia RMFSL200 è stata valutata attraverso il programma di simulazione SLINK per calcolare il potere statistico sufficiente per determinare il linkage, il quale dipende da fattori come la struttura della famiglia, il numero degli affetti, l’informatività dei marcatori. Questa famiglia presentava una forma ad esordio precoce di ADHSP non complicata ad espressività variabile, con anticipazione genetica. Le size degli alleli sono stati analizzati con il software GENEMAPPER (versione 4.0). I punteggi di logaritmo di odds (LOD scores) sono stati calcolati usando il sottoprogramma MLINK del pacchetto di software LINKAGE (versione 5.2). MLINK è la funzionalità di LINKAGE più utilizzata: consente di calcolare i LOD score a due punti per valori desiderati della frazione di ricombinazione. Il suo limite è che non può operare su più di 8 loci per volta in famiglie senza consanguineità (in famiglie con consanguineità si scende a 4, 5 loci).

111 

Tabella 4.1. Analisi d’esclusione: LOD scores a due punti per i loci noti ADHSP. Sottotipo

Marcatori

SPG

microsatellitari

0.0

0.1

0.2

0.3

0.4

0.5

SPG3A

D14S288

2.36

1.91

1.43

0.91

0.39

0.00

D14S276

1.78

1.42

1.04

0.63

0.24

0.00

D2S165

–5.43

–0.55

0.05

0.11

0.11

0.00

D2S367

0.59

0.49

0.39

0.27

0.15

0.00

D15S128

0.10

0.24

0.26

0.22

0.13

0.00

D15S165

–5.16

–0.45

–0.01

0.13

0.11

0.00

D12S368

–5.71

–0.19

–0.07

–0.03

–0.01

0.00

D12S83

0.60

0.50

0.39

0.28

0.15

0.00

D19S220

–5.92

–1.68

–0.77

–0.32

–0.08

0.00

D19S414

0.29

0.23

0.18

0.12

0.06

0.00

D8S514

–6.95

–1.87

–0.99

–0.52

–0.21

0.00

D8S284

–6.64

–0.71

–0.30

–0.12

–0.03

0.00

D2S306

–5.32

0.02

0.16

0.13

0.05

0.00

D2S335

–0.35

–0.14

–0.05

–0.01

0.01

0.00

D2S286

–6.69

–0.67

–0.19

–0.01

0.04

0.00

D2S388

–7.22

–0.74

–0.26

–0.05

0.03

0.00

SPG4 SPG6 SPG10 SPG12 SPG8 SPG13 SPG31

LOD score per la frazione di ricombinazione (θ)

Nota: per la descrizione dei microsatelliti si rimanda in appendice (tabella 7.2)

L’analisi dei dati ha evidenziato in realtà valori di LOD score altamente significativi per SPG3A (vedi Tab. 4.1) quindi si è proceduto con l’indagine molecolare per sequenziamento diretto dell’isoforma a del suddetto gene.

Figura 4.2. Elettroferogramma del paziente FSL1252 mostra cambio nucleotidico c. 1246 C>T (Htz).

112 

Il sequenziamento diretto dei 14 esoni e delle loro regioni fiancheggianti ha evidenziato una transizione C>T in stato di eterozigosi nell’esone 12 (Fig. 4.2). Questo cambio nucleotidico genera una modifica nella proteina con una sostituzione di una Arginina con una Cisteina in posizione 416 della sequenza dell’Atlasina (NP_056999.2). La mutazione p.R416C è stata confermate tramite una seconda PCR indipendente eseguita sul probando. La segregazione della mutazione missenso, all’interno della famiglia, è stata verificata tramite digestione con l’enzima di restrizione NaeI (Fig. 4.3).

Figura 4.3. Segregazione della mutazione p.R416C all’interno della famiglia RMFSL200.

Le restanti otto famiglie ADHSP non erano sufficientemente informative per procedere ad analisi di linkage. Quindi tutti i probandi delle famiglie e i casi apparentemente sporadici (18) sono stati sottoposti a studio per sequenziamento diretto del gene SPG3A. Tabella 4.2. Pazienti con mutazioni in SPG3A.

113 

ID paziente /Famiglia

FSL1252 /RMFSL200

FSL671/RMFSL79

JAP106

Mutazione

c.1246 C>T

c.1246 C>T

c.1243 C>T

g.68126 C>T

g.68126 C>T

g.68123 C>T

Cambio aminoacidico

p.R416C

p.R416C

p.R415W

Sesso

M

M

M

Etnia

Caucasico

Caucasico

Asiatico

Modalità di ereditarietà ADHSP

ADHSP

Sporadico

Età di esordio

18aa

6aa

10aa

Età alla I visita

55aa

34aa

59aa

Fenotipo

Non complicato, anticipazione genetica

Non complicato, anticipazione genetica

Non complicato

Sono state individuate due mutazioni missenso, una delle quali è presente nei probandi delle due famiglie non imparentate RMFSL200 e RMFSL79. Il fenotipo dei tre pazienti è sostanzialmente puro. Le due famiglie presentano entrambe espressività variabile con anticipazione genetica. Infine, per escludere la presenza della mutazione p.R416C nella popolazione sana è stata effettuato uno screening con digestione tramite NaeI su 200 cromosomi di controllo. Tale analisi ha escluso che la variante individuata in SPG3A possa essere un polimorfismo (fig. 4.4).

Figura 4.4. Digestione con enzima di restrizione NaeI su 200 cromosomi di controllo. Ogni pool è costituito da 10 controlli per un totale di 200 cromosomi.

Il cambio aminoacidico R416C è localizzato entro il motivo “SRR” nel dominio “protein kinase C phosphorylation” (“dominio 5” da Zhao et al., 2001). Questo aminoacido è identico nella famiglia dell’atlastina umana (ATL1, ATL2, ATL3) (Zhu et al., 2003), ed inoltre la regione tra gli aminoacidi 402 e 422 è altamente conservata in differenti specie (Mus musculus, Rattus norvegicus, Macaca fascicularis, Gallus gallus and Xenopus tropicalis) (fig4.5).

Figura 4.5. Analisi comparativa della regione altamente conservata di ATL tra gli aminoacidi da 402 a 422 in differenti specie.

114 

La seconda variante g.68123 C>T è stata trovata, in stato di eterozigosi, in un paziente apparentemente sporadico proveniente dal Giappone (JAP106) (Fig. 4.6). Dal punto di vista della proteina la mutazione genera una sostituzione di una Arginina con una Treonina in posizione 415. Questo cambio aminoacidico era già stato riportato in letteratura (D’amico et al., 2004).

Figura 4.6. Elettroferogramma del paziente JAP106 mostra il cambio nucleotidico c. 1243 C>T (Htz).

L’analisi del campione SPG3A ha evidenziato due polimorfismi già riportati nella banca dati delle SNPs e due già ritrovati in letteratura (Tab.4.3). Tabella 4.3. Polimorfismi identificati nel gene SPG3A. Polimorfismo

Cambio nucleotidico a livello genomico

Status

Pazienti

Bibiografia

SNPs

p. P28P

g.27849 A>G

Htz

4

rs355014209

p.E117E

g.30978 G>A

Htz/Hmz

16

rs1060197

IVS4 -19 G>T

g.31485 G>T

Htz/Hmz

25

Durr et al., 2004

IVS6 +7 G>A

g.35608 G>A

Htz

3

Durr et al., 2004

(n)

Successivamente, al fine di verificare grandi delezioni o inserzioni, sui pazienti negativi per lo studio del gene SPG3A è stata effettuata l’analisi tramite MLPA, che non ha indicato la presenza di anomalie quantitative, indicativo dell’assenza di riarrangiamenti nel gene per i pazienti esaminati.

115 

4.2 Analisi del gene SPG5A. L’analisi del gene SPG5A è stata effettuata esclusivamente mediante sequenziamento diretto per le caratteristiche delle famiglie ARHSP e per l’assenza del kit MLPA specifico per SPG5A. Un totale di 17 pazienti apparentemente sporadici, negativi per SPG3A e i probandi di 3 famiglie ARHSP sono stati sottoposti a studio per sequenziamento diretto del gene SPG5A. In due pazienti apparentemente sporadici sono state trovate tre mutazioni di cui due nuove e una già nota (Tab. 4.4). Tabella 4.4. Pazienti con mutazioni in SPG5A.

ID paziente

FSL1263

FSL1122

/Famiglia Mutazione

c. 995 T>C

c.1362insT, g.201991insT201992;

g.183042 T>C

c.344C>T, g.182595 C>T;

Stato

Hmz

Htz composita

Cambio

p.F264S

p.A453CfsX470;

aminoacidico

p.S115F

Sesso

F

M

Etnia

Caucasico

Caucasico

Modalità di

sporadico

sporadico

Età di esordio

5aa

9aa

Età alla I visita

53aa

28aa

Fenotipo

Neuroimmagini: Atrofia ottica bilaterale. Ipotrofia nuclei caudato e putamen.

Non complicato

ereditarietà

La prima mutazione trovata nell’individuo FSL1263, non riportata in letteratura, riguarda la sostituzione nucleotidica T>C in posizione 183042 della sequenza genomica CYP7B1 (NT_008183) in omozigosi (Fig. 4.7). Dal punto di vista della proteina la mutazione genera un cambio aminoacidico Fenilalanina in Serina alla posizione 264 (NP_004811). Il fenotipo della paziente è apparso complicato da riduzione del visus e parkinsonismo, con neuroimmagini positive per “atrofia ottica bilaterale e ipotrofia dei nuclei caudato e putamen”. 116 

Figura 4.7. Elettroferogramma del paziente FSL1263 mostra il cambio nucleotidico c. 995 T>C (Hmz).

In un secondo paziente apparentemente sporadico (FSL1122), con fenotipo puro, sono state individuate due mutazione in eterozigosi composita. La prima mutazione già riportata in letteratura (Criscuolo et al., 2009), è rapprentata da una inserzione di una Timina in posizione 1362 della sequenza codificante (NM_004820) (Fig.4.8). L’inserzione crea un frameshift a livello di traduzione e genera un codone di stop dopo 17 amminoacidi (p.A453CfsX470).

Figura 4.8. Elettroferogramma del paziente FSL1122 mostra l’inserzione c.1362insT.

Il secondo cambio nucleotidico, ad oggi non riportato, è rappresentato da una transizione C>T in posizione 344 del c.DNA (Fig. 4.9). La mutazione provoca la sostituzione della Serina in posizione 115 con una Fenialanina.

117 

Figura 4.9. Elettroferogramma del paziente FSL1122 mostra il cambio nucleotidico c. 344 C>T (Htz).

Anche per le mutazioni non note di SPG5A è stato effettuato uno studio sulla popolazione sana per verificare se le varianti fossero dei polimorfismi. L’analisi tramite enzima di restrizione effettuata siu circa 200 cromosomi di controllo ha evidenziato il non polimorfismo. In figura 4.8 è stata riportata, come esempio, la digestione con enzima XmnI su 210 cromosomi di controllo, per la mutazione p.F264S (fig. 4.10).

Fig. 4.10. Digestione con enzima di restrizione XmnI su 210 cromosomi di controllo. Ogni pool è costituito da 15 controlli per un totale di 210 cromosomi.

Tramite l’allineamento delle sequenze proteiche di diverse specie si è osservato che il residuo aminoacidico sostituito dalla mutazione missenso (p.F264S) è conservato attraverso l’evoluzione (Fig. 4.11).

118 

Fig. 4.11. Analisi comparativa della regione di CYP7B1 tra gli aminoacidi da 249 a 280 in differenti specie.

Infine l’analisi del campione ha evidenziato un polimorfismo nuovo e polimorfismi già noti per il gene SPG5A (Tab.4.5). Tabella 4.5. Polimorfismi identificati nel gene SPG5A. Polimorfismo

Cambio nucleotidico a livello genomico

Status

Pazienti

Bibiografia

g.116 C>G (5’UTR) c.122 + 19 A>T

g.116 C>G (5’UTR) g.345 A>T

Htz

1

Presente studio

Hmz/Htz

16

Schulle et al., 2008

c.971 G>A,

g.183680 G>A

Htz

3

Schulle et al., 2008

(n)

p.R324H   E’ interessante osservare che il cambio nucleotidico C>G presente nel paziente AO184, cade nella regione 5’UTR che precede l’ATG, ma tale trasversione non altera il sito di splicing.

119 

4.3 Analisi del gene SPG42 Il gene SPG42 è stato analizzato mediante sequenziamento diretto dei probandi delle famiglie negative per SPG3A (7) e nei pazienti sporadici (15) negativi per l’analisi dei due geni SPG3A e SPG5A candidati come più frequenti nelle forme ad esordio precoce. La scelta dello studio di questo gene è stata guidata dalle caratteristiche cliniche dell’unica famiglia riportata in letteratura (Lin et al., 2008) e per la frequenza al momento della scelta sconosciuta, nonché dalla struttura della sequenza genomica relativamente non complessa (6 esoni). L’analisi mediante sequenziamento diretto non ha evidenziato mutazioni patogenetiche. In 3 pazienti si è evidenziata la presenza di un polimorfismo in posizione 893 della sequenza genomica, precisamente questa variante nell’esone 1 è una transizione A>G. Tale cambio nucleotidico genera una sostituzione di un Acido Aspartico con una Glicina in posizione 171 della sequenza aminoacidica della proteina SLC33A1 (NP_004724.1). Il polimorfismo è presente in forma eterozigote nel nostro campione. Tale cambio nucleotidico è già stato riportato nella banca dati delle SNPs (rs3804796). Tabella 4.6 Polimorfismi identificati nel gene SPG42. Esone

Mutazione

Effetto sulla proteina

Status

Tipo di mutazione

Pazienti (n)

SNPs

Esone 1

g.893 T>C

D171G

Htz

Transizione

3

rs3804796

120 

Capitolo 5 – DISCUSSIONE E CONCLUSIONI L’indagine molecolare condotta su 18 casi sporadici e 9 familiari affetti da forme ad esordio precoce di HSP è stata effettuata attraverso l’analisi dei geni SPG3A, SPG5A e SPG42. Questo studio ha portato all’identificazione di cinque mutazioni diverse di cui una frameshift e le rimanenti missenso. Due mutazioni missenso sono state identificate nel gene ATL1, di cui una non ancora riportata in letteratura (c.1246 C>T, p.R416C) e l’altra già nota (c.1243 C>T, p.R415W) (D’amico et al., 2004). Per quanto riguarda lo studio del gene CYP7B1 ho identificato due mutazioni missenso non ancora riportate in letteratura (c. 995 T>C, p.F264S e c.344C>T, p.S115F) e un’inserzione che esita in un frameshift con l’introduzione di uno stop prematuro dopo 17 amminoacidi al codone C-terminale della proteina (c.1362insT, p.A453CfsX470) già riportata in letteratura (Criscuolo et al., 2009). Attraverso il sequenziamento diretto degli esoni codificanti e delle regioni fiancheggianti gli introni del gene SPG3A è stata individuata la mutazione missenso nell’esone 12 al nucleotide c.1246 C>T, che causa una sostituzione aminoacidica dell’Arginina in posizione 416 con una Cisteina. La stessa mutazione missenso p.R416C è condivisa da una seconda famiglia italiana del campione che ho esaminato. Le due famiglie, non imparentate, manifestano un fenotipo sostanzialmente sovrapponibile, con ADHSP pura ad esordio precoce e una espressività variabile con un probabile meccanismo di anticipazione genetica. Un cambio simile nella stessa posizione della proteina ATL1 è stato di recente identificato da uno studio su un’altra famiglia italiana (de Leva et al., 2009), in cui la Arginina 416 è sostituita da una Istidina. Questo cambio aminoacidico è localizzato all’interno del motivo “SRR” nel dominio “protein kinase C phosphorylation” (“dominio 5” da Zhao et al., 2001), nella metà di una alfa elica vicino al C-terminale, poco prima del dominio transmembrana. Questo aminoacido è conservato nella famiglia dell’atlastina umana (ATL1, ATL2, ATL3) (Zhu et al., 2003), ed inoltre la regione tra gli aminoacidi 402 e 422 è altamente conservata in differenti specie (Mus musculus, Rattus norvegicus, Macaca fascicularis, Gallus gallus and Xenopus tropicalis). L'analisi in silico con il software predittivo PolyPhen indica che la sostituzione aminoacidica potrebbe alterare la struttura della proteina. Poiché la mutazione p.R416C non ricade all’interno del dominio catalitico GTPasi, si potrebbe ipotizzare che ci possa essere un ruolo nella associazione di membrana o nella oligomerizzazione, probabilmente esercitando un 121 

effetto patogenetico attraverso la formazione di una struttura secondaria alterata che disturba l’interazione della atlastina con altre proteine. Entrambe le mutazioni osservate nell’analisi del gene SPG3A ricadono all’interno dell’esone 12. Questo studio si aggiunge ai precedenti che indicano l’esone 12 come un hotspot mutazionale con una frequenza fino al 35% delle mutazioni in SPG3A (Namekawa et al., 2006, Smith et al., 2009). Attraverso il sequenziamento diretto per il gene SPG5A ho individuato una seconda mutazione missenso, non ancora pubblicata in letteratura, in una paziente apparentemente sporadica con fenotipo complicato da riduzione del visus e parkinsonismo, ed un quadro di neuroimmagini che indica atrofia ottica bilaterale e ipotrofia dei nuclei caudato e putamen. Questa mutazione riguarda la transizione T>C in posizione 183042 della sequenza genomica di SPG5A in stato di omozigosi, e prevede la sostituzione di una Fenilalanina con una Serina in posizione 264 della proteina. Il residuo aminoacidico sostituito dalla mutazione missenso è conservato attraverso l’evoluzione tra le specie (Homo sapiens, Pan troglodytes, Macaca mulatta) e da ciò si può ipotizzare la sua patogenicità per la funzione della proteina CYP7B1. In questo caso un amminoacido aromatico (Ser), con un notevole ingombro sterico, viene sostituito da un amminoacido polare non carico (Phe). Dunque, questo cambio amminoacidico potrebbe provocare un’alterazione nella struttura proteica e quindi della sua funzione. La sostituzione p.Phe264Ser genera, inoltre, un sito ipotetico di fosforilazione osservato mediante il programma NetPhos. Infatti, la fosforilazione dei residui di Serina agisce come regolatore importante per la funzione di molte molecole di citocromo P450 (Oesh-Bartlomowicz et al., 2003). Le mutazioni individuate nell’analisi del gene SPG5A nel presente studio interessano due pazienti, con manifestazioni cliniche in un caso pure e nel secondo complicate. La scelta di estendere lo screening per di gene anche alle forme complicate di HSP è in accordo a quanto riportato in letteratura (Goizet et al., 2009). L’analisi MLPA effettuata nei pazienti candidati per SPG3A (kit P165-HSP-B1, MRCHolland) non ha individuato nessun cambiamento patogenetico. L’assenza di riarrangiamenti patogenetici nel presente studio non sorprende, poiché in letteratura tale tecnica è indicata come più utile in patologie in cui la frequenza di numero di 122 

copie aberranti è maggiore, piuttosto che nelle malattie ereditarie in cui le parziali delezioni o duplicazioni geniche costituiscono circa il 10% di tutte le mutazioni causative di malattia. In letteratura è riportata solo una famiglia in cui è stata identificata la delezione patogenetica dell’esone 1 in SPG4 e la delezione dell’intero gene SPG3A (Beetz et al.,2007). Questo studio ha comunque contribuito ad arricchire lo spettro mutazionale dei geni SPG3A e SPG5A confermando l’eterogeneità sia intra che iter locus nella genetica delle HSP. Sono risultati positivi per l’analisi tramite sequenziamento diretto del gene ATL1 tre pazienti, di cui due probandi di famiglie ADHSP e un caso apparentemente sporadico, in un campione di 27 soggetti che presentavano forme di HSP ad esordio precoce (11,1%). I pazienti positivi per mutazioni nel gene SPG5A sono due soggetti apparentemente sporadici, in un campione di 21 soggetti che ha incluso solo tre famiglie ARHSP (9,5%). I risultati ottenuti in questa tesi confermano i dati osservati in letteratura per cui i geni SPG3A e SPG5A mostrano una alta frequenza mutazionale nelle forme ad esordio precoce di ADHSP e ARHSP (rispettivamente il 10% e il 7%) e nei casi apparentemente sporadici.

 

123 

Capitolo 6 – BIBLIOGRAFIA



Abel, A.; Fonknechten, N.; Hofer, A.; Durr, A.; Cruaud, C.; Voit, T.; Weissenbach, J.; Brice, A.; Klimpe, S.; Auburger, G.; Hazan, J. Early onset autosomal dominant spastic paraplegia caused by novel mutations in SPG3A. Neurogenetics 5: 239-243, 2004.

 Al Yahyaee S, Al Gazali LI, De Jonghe P, et al.: A novel locus for hereditary spastic paraplegia with thin corpus callosum and epilepsy.Neurology 2006, 66:1230–1234.  Alber B, Pernauer M, Schwan A, et al. Spastin related hereditary spastic paraplegia with dysplastic corpus callosum. J Neurol Sci 2005; 236: 9–12. 

Allan VJ, Thompson HM, McNiven MA. Motoring around the Golgi. Nat Cell Biol 2002;4:236–42

 Andersson S, Gustafsson N, Warner M, Gustafsson JA: Inactivation of liver X receptor beta leads to adult-onset motor neuron degeneration in male mice. Proc Natl Acad Sci U S A 2005, 102:3857–3862.  Arnoldi A, Tonelli A, Crippa F, Villani G, Pacelli C, Sironi M, Pozzoli U, D'Angelo MG, Meola G, Martinuzzi A, Crimella C, Redaelli F, Panzeri C, Renieri A, Comi GP, Turconi AC, Bresolin N, Bassi MT. A clinical, genetic, and biochemical characterization of SPG7 mutations in a large cohort of patients with hereditary spastic paraplegia. Hum Mutat. 2008, 29(4):522-31.  Auer-Grumbach, M.; Schlotter-Weigel, B.; Lochmuller, H.; Strobl-Wildemann, G.; AuerGrumbach, P.; Fischer, R.; Offenbacher, H.; Zwick, E. B.; Robl, T.; Hartl, G.; Hartung, H.P.; Wagner, K.; Windpassinger, C.; Austrian Peripheral Neuropathy Study Group : Phenotypes of the N88S Berardinelli-Seip congenital lipodystrophy 2 mutation. Ann. Neurol. 57: 415-424, 2005.  Bakowska JC, Jupille H, Fatheddin P, et al.: Troyer syndrome protein spartin is monoubiquitinated and functions in EGF receptor trafficking. Mol Biol Cell 2007, 18:1683– 1692.  Battistella PA, Suppiej A, Mandara V: Evoked potentials in familial spastic paraplegia: description of three brothers and review of the literature. Giorn Neuropsi Evol 1997, 17:201–212. 

Bayley, W. D. Hereditary spastic paraplegia. J. Nerv. Ment. Dis. 24: 697-701, 1897.

 Beetz C, Nygren A O, Schickel J, et al. High frequency of partial SPAST deletions in autosomal dominant hereditary spastic paraplegia. Neurology 2006; 67:1926–1930. 

Beetz, C.; Nygren, A. O. H.; Deufel, T.; Reid, E. An SPG3A whole gene deletion neither co-segregates with disease nor modifies phenotype in a hereditary spastic paraplegia family with a pathogenic SPG4 mutation. (Letter) Neurogenetics 8: 317-318, 2007. 124 



Behan, W. M. H.; Maia, M. Strumpell's familial spastic paraplegia: genetics and neuropathology. J. Neurol. Neurosurg. Psychiat. 37: 8-20, 1974.

 Biancheri R, Ciccolella M, Rossi A, Tessa A, Cassandrini D, Minetti C, Santorelli FM. White matter lesions in spastic paraplegia with mutations in SPG5/CYP7B1. Neuromuscul Disord. 2009 Jan;19(1):62-5. 

Bizzi A, Castelli G, Bugiani M, Barker PB, Herskovits EH, Danesi U, et al. Classification of childhood white matter disorders using proton MR spectroscopic imaging. Am J Neuroradiol 2008; 29: 1270–5.

 Blair MA, Riddle ME, Wells JF, et al.: Infantile onset of hereditary spastic paraplegia poorly predicts the genotype. Pediatr Neurol 2007,36:382–386.  Boukhris A, Stevanin G, Feki I, Denora P, Elleuch N, Miladi MI, Goizet C, Truchetto J, Belal S, Brice A, Mhiri C. Tunisian hereditary spastic paraplegias: clinical variability supported by genetic heterogeneity. Clin Genet. 2009 Jun;75(6):527-36. Epub 2009 May 5. 

Boukhris A, Stevanin G, Feki I, et al.: Hereditary spastic paraplegia with mental impairment and thin corpus callosum in Tunisia: SPG11, SPG15 and further genetic heterogeneity. Arch Neurol 2008, 65:393–402

 Bouslam N, BouhoucheA, Benomar A, et al. A novel locus for autosomal recessive spastic ataxia on chromosome 17p. Hum Genet 2007;121:413–420. 

Boustany, R.-M. N.; Fleischnick, E.; Alper, C. A.; Marazita, M. L.; Spence, M. A.; Martin, J. B.; Kolodny, E. H. The autosomal dominant form of 'pure' familial spastic paraplegia: clinical findings and linkage analysis of a large pedigree. Neurology 37: 910-915, 1987.

 Braschinsky M, Luus SM, Gross-Paju K, Haldre S. The prevalence of hereditary spastic paraplegia and the occurrence of SPG4 mutations in Estonia. Neuroepidemiology. 2009;32(2):89-93. Epub 2008 Nov 27.  Braschinsky M, Zopp I, Kals M, Haldre S, Gross-Paju K. Bladder Dysfunction in Hereditary Spastic Paraplegia: What to Expect? J Neurol Neurosurg Psychiatry. 2009 Sep 2. [Epub ahead of print]  Brugman F, Scheffer H, Schelhaas HJ, Nillesen WM, Wokke JH, van de Warrenburg BP, van den Berg LH. Seipin/BSCL2 mutation screening in sporadic adult-onset upper motor neuron syndromes. J Neurol. 2009 May;256(5):824-6.  Brugman F, Scheffer H, Wokke JHJ, et al. Paraplegin mutations in sporadic adult-onset upper motor neuron syndromes. Neurology 2008;71:1500–1505.  Bruyn RP. The neuropathology of hereditary spastic paraplegia. Clin Neurol Neurosurg 1992; 94 (suppl): S16–18. 

125 

Burdick, A. B.; Owens, L. A.; Peterson, C. R. Slowly progressive autosomal dominant spastic paraplegia with late onset, variable expression and reduced penetrance: a basis for diagnosis and counseling. Clin. Genet. 19: 1-7, 1981.

 Byrne P, McMonagle P, Webb S, Fitzgerald B, Parfery NA, Hutchinson M. Age-related cognitive decline in hereditary spastic paraplegia linked to chromosome 2p. Neurology 2000, 54: 1510–17.  Cambi F, Tartaglino L, Lublin F, et al. X-linked pure familial spastic paraparesis: characterization of a large kindred with magnetic resonance imaging studies. Arch Neurol 1995;52:665– 69.  Casali C, Valente EM, Bertini E, et al. Clinical and genetic studies in hereditary spastic paraplegia with thin corpus callosum. Neurology 2004;62:262– 68. 

Casari G, De Fusco M, Ciarmatori S, et al. Spastic paraplegia and OXPHOS impairment caused by mutations in paraplegin, a nuclear-encoded mitochondrial metalloprotease. Cell1998; 93:973–83

 Chan KY, Ching CK, Mak CM, Lam CW, Chan AY. Hereditary spastic paraplegia: identification of an SPG3A gene mutation in a Chinese family. Hong Kong Med J. 2009 Aug;15(4):304-7.  Claus D, Jaspert A: Central motor conduction in hereditary spastic paraparesis (Strumpell’s disease) and tropical spastic paraparesis. Neurol Croatica 1995, 44:23–31.  Claus D, Waddy HM, Harding AE: Hereditary motor and sensory neuropathies and hereditary spastic paraplegia: a magnetic stimulation study. Ann Neurol 1990, 28:43–49. 

Cooley, W. C.; Melkonian, G.; Moses, C.; Moeschler, J. B. Autosomal dominant familial spastic paraplegia: description of a large New England family and a study of management. Dev. Med. Child Neurol. 32: 1087-1104, 1990.



Cooley, W. C.; Rawnsley, E.; Melkonian, G.; Moses, C.; McCann, D.; Virgin, B.; Coughlan, J.; Moeschler, J. B. Autosomal dominant familial spastic paraplegia: report of a large New England family. Clin. Genet. 38: 57-68, 1990.



Coutinho P, Barros J, Zemmouri R, et al.: Clinical heterogeneity of autosomal recessive spastic paraplegias: analysis of 106 patients in 46 families. Arch Neurol 1999, 56:943–949

 Crimella C, Arnoldi A, Crippa F, Mostacciuolo ML, Boaretto F, Sironi M, D'Angelo MG, Manzoni S, Piccinini L, Turconi AC, Toscano A, Musumeci O, Benedetti S, Fazio R, Bresolin N, Daga A, Martinuzzi A, Bassi MT. Point mutations and a large intragenic deletion in SPG11 in complicated spastic paraplegia without thin corpus callosum. J Med Genet. 2009 May;46(5):345-51. Epub 2009 Feb 5.  Crippa F, Panzeri C, Martinuzzi A, et al.: Eight novel mutations in SPG4 in a large sample of patients with hereditary spastic paraplegia. J Paediatr Child Health 2006, 63:750–755.  Criscuolo C, Filla A, Coppola G, Rinaldi C, Carbone R, Pinto S, Wang Q, de Leva MF, Salvatore E, Banfi S, Brunetti A, Quarantelli M, Geschwind DH, Pappatà S, De Michele G. Two novel CYP7B1 mutations in Italian families with SPG5: a clinical and genetic study. J Neurol. 2009 Aug;256(8):1252-7. Epub 2009 Apr 12. 126 

 CriscuoloC, SaccaF,DeMicheleG,etal. Novel mutation of SACS gene in a Spanish family with autosomal recessive spastic ataxia. MovDisord 2005; 20:1358–1361.  Crosby AH, Proukakis C. Is the transportation highway the right road for hereditary spastic paraplegia? Am J Hum Genet 2002; 71: 1009–16. 

D'Amico, A.; Tessa, A.; Sabino, A.; Bertini, E.; Santorelli, F. M.; Servidei, S. Incomplete penetrance in an SPG3A-linked family with a new mutation in the atlastin gene. Neurology 62: 2138-2139, 2004.



Dalpozzo, F.; Rossetto, M. G.; Boaretto, F.; Sartori, E.; Mostacciuolo, M. L.; Daga, A.; Bassi, M. T.; Martinuzzi, A. Infancy onset hereditary spastic paraplegia associated with a novel atlastin mutation. Neurology 61: 580-581, 2003.

 de Leva MF, Filla A, Criscuolo C, Tessa A, Pappatà S, Quarantelli M, Bilo L, Peluso S, Antenora A, Longo D, Santorelli FM, De Michele G. Complex phenotype in an Italian family with a novel mutation in SPG3A. J Neurol. 2009 Sep 19. [Epub ahead of print]  De Michele G, DeFusco M, Cavalcanti F, et al.: A new locus for autosomal recessive hereditary spastic paraplegia maps to chromosome 16q24.3. Am J Hum Genet 1998, 63:135–139.  Deluca GC, Ebers GC, Esiri MM. The extent of axonal loss in the long tracts in hereditary spastic paraplegia. Neuropathol Appl Neurobiol 2004; 30: 576–84.  Denora PS, Schlesinger D, Casali C, Kok F, Tessa A, Boukhris A, Azzedine H, Dotti MT, Bruno C, Truchetto J, Biancheri R, Fedirko E, Di Rocco M, Bueno C, Malandrini A, Battini R, Sickl E, de Leva MF, Boespflug-Tanguy O, Silvestri G, Simonati A, Said E, Ferbert A, Criscuolo C, Heinimann K, Modoni A, Weber P, Palmeri S, Plasilova M, Pauri F, Cassandrini D, Battisti C, Pini A, Tosetti M, Hauser E, Masciullo M, Di Fabio R, Piccolo F, Denis E, Cioni G, Massa R, Della Giustina E, Calabrese O, Melone MA, De Michele G, Federico A, Bertini E, Durr A, Brockmann K, van der Knaap MS, Zatz M, Filla A, Brice A, Stevanin G, Santorelli FM. Screening of ARHSP-TCC patients expands the spectrum of SPG11 mutations and includes a large scale gene deletion. Hum Mutat. 2009 Mar;30(3):E500-19.  Depienne C, Fedirko E, Faucheux JM, et al.: A de novo SPAST mutation leading to somatic mosaicism is associated with a later age at onset in HSP. Neurogenetics 2007, 8:231–233.  Depienne C, Fedirko E, Forlani S, et al. Exon deletions of SPG4 are a frequent cause of hereditary spastic paraplegia. J Med Genet 2007; 44:281–284.  Depienne C, Tallaksen C, Lephay JY, et al.: Spastin mutations are frequent in sporadic spastic paraparesis and their spectrum is different from the one observed in familial cases. J Med Genet 2006,43:259–265. 

Depienne, C., Stevanin, G., Brice, A., Dürr, A., 2007. Hereditary spastic paraplegias: an update. Curr. Opin. Neurol. 20, 674-680

 Di Bella D, Mariotti C, Plumari M, et al.:Molecular and functional analysis of paraplegin gene (SPG7) mutations in patients with familial and sporadic spastic paraplegia [abstract 127 

848]. Paper presented at the annual meeting of The American Society of Human Genetics. San Diego, CA; October 23–27, 2007. http://www.ashg.org/genetics/ashg07s/index.shtml. 

Dib, C., Faure S, Fizames C, Samson D, Drout N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Wiessenbach J. A comprehensive genetic map of the human genome based on 5,264 microsatellites. Nature, 1996. 380:6570, 152– 154.

 Dick KJ, Al-Mjeni R, Baskir W, Koul R, Simpson MA, Patton MA, Raeburn S, Crosby AH. A novel locus for an autosomal recessive hereditary spastic paraplegia (SPG35) maps to 16q21-q23. Neurology. 2008 Jul 22;71(4):248-52. Epub 2008 May 7.  Dion PA, Daoud H, Rouleau GA. Genetics of motor neuron disorders: new insights into pathogenic mechanisms. Nat Rev Genet. 2009 Nov;10(11):769-82.  Dreha-Kulaczewski S, Dechent P, Helms G, et al. Cerebral metabolic and structural alterations in hereditary spastic paraplegia with thin corpus callosum assessed by MRS and DTI. Neuroradiology 2006; 48:893–98. 

Dube, M.-P.; Mlodzienski, M. A.; Kibar, Z.; Farlow, M. R.; Ebers, G.; Harper, P.; Kolodny, E. H.; Rouleau, G. A.; Figlewicz, D. A. Hereditary spastic paraplegia: LOD-score considerations for confirmation of linkage in a heterogeneous trait. Am. J. Hum. Genet. 60: 625-629, 1997.



Dürr, A., 2008. Genetic testing for the spastic paraplegias: drowning by numbers. Neurology 71, 236–238.



Durr, A.; Brice, A.; Serdaru, M.; Rancurel, G.; Derouesne, C.; Lyon-Caen, O.; Agid, Y.; Fontaine, B. The phenotype of 'pure' autosomal dominant spastic paraplegia. Neurology 44: 1274-1277, 1994.



Durr, A.; Camuzat, A.; Colin, E.; Tallaksen, C.; Hannequin, D.; Coutinho, P.; Fontaine, B.; Rossi, A.; Gil, R.; Rousselle, C.; Ruberg, M.; Stevanin, G.; Brice, A. Atlastin1 mutations are frequent in young-onset autosomal dominant spastic paraplegia. Arch. Neurol. 61: 1867-1872, 2004.

 Dursun U, Koroglu C, Kocasoy Orhan E, Ugur SA, Tolun A. Autosomal recessive spastic paraplegia (SPG45) with mental retardation maps to 10q24.3-q25.1. Neurogenetics. 2009 Oct;10(4):325-31. Epub 2009 May 5.  Eastman SW, Yassaee M, Bieniasz PD. A role for ubiquitin ligases and Spartin/SPG20 in lipid droplet turnover. J Cell Biol. 2009 Mar 23;184(6):881-94.  Engert JC, BerubeP, MercierJ, et al. ARSACS, a spastic ataxia common in northeastern Quebec, is caused by mutations in a new gene encoding an 11.5-kb ORF. Nat Genet 2000; 24:120–125  Erichsen AK, Koht J, Stray-Pedersen A, Abdelnoor M, Tallaksen CM. Prevalence of hereditary ataxia and spastic paraplegia in southeast Norway: a population-based study. Brain. 2009 Jun;132(Pt 6):1577-88. Epub 2009 Mar 31. 128 



Evans, K.; Keller, C.; Pavur, K.; Glasgow, K.; Conn, B.; Lauring, B. Interaction of two hereditary spastic paraplegia gene products, spastin and atlastin, suggests a common pathway for axonal maintenance. Proc. Nat. Acad. Sci. 103: 10666-10671, 2006.

 Filla A, DeMichele G, Marconi R, Bucci L, Carillo C, Castellano AE, Iorio L, Kniahynicki C, Rossi F, Campanella G (1992). Prevalence of hereditary ataxias and spastic paraplegias in Molise, a region of Italy. J Neurol 239: 351–353.  Fink JK: Progressive spastic paraparesis: hereditary spastic paraplegia and it’s relation to primary and amyotrophic lateral sclerosis. Semin Neurol 2001, 21:199–208.  Fink JK. Advances in the hereditary spastic paraplegias. Exp Neurol 2003; 184 (suppl 1): S106–10. 

Fink JK. Hereditary spastic paraplegia. Curr Neurol Neurosci Rep 2006, 6 :65–76.



Fink, J. K. Advances in hereditary spastic paraplegia. Curr. Opin. Neurol. 10: 313-318, 1997.



Fink, J. K.; Heiman-Patterson, T.; Bird, T.; Cambi, F.; Dube, M.-P.; Figlewicz, D. A.; Haines, J. L.; Hentati, A.; Pericak-Vance, M. A.; Raskind, W.; Rouleau, G. A.; Siddique, T. Hereditary spastic paraplegia: advances in genetic research. Neurology 46: 1507-1514, 1996.



Finsterer, J., 2003. Hereditary spastic paraplegia. Nervenarzt 74, 497–504.

 Fonknechten N, Mavel D, ByrneP, et al. Spectrum of SPG4 mutations in autosomal dominant spastic paraplegia. HumMol Genet 2000; 9:637–644.  Franca MC Jr, D’Abreu A, Maurer-Morelli CV, et al.: Prospective neuroimaging study in hereditary spastic paraplegia with thin corpus callosum.Mov Disord 2007, 22:1556–1562.  Fusco C, Frattini D, Farnetti E, Nicoli D, Casali B, Fiorentino F, Nuccitelli A, Giustina ED. Hereditary spastic paraplegia and axonal motor neuropathy caused by a novel SPG3A de novo mutation. Brain Dev. 2009 Sep 5. [Epub ahead of print] 

Garland, H. G.; Astley, C. E. Hereditary spastic paraplegia with amyotrophy and pes cavus. J. Neurol. Neurosurg. Psychiat. 13: 130-133, 1950.



Gispert, S.; Santos, N.; Damen, R.; Voit, T.; Schulz, J.; Klockgether, T.; Orozco, G.; Kreuz, F.; Weissenbach, J.; Auburger, G. Autosomal dominant familial spastic paraplegia: reduction of the FSP1 candidate region on chromosome 14q to 7 cM and locus heterogeneity. Am. J. Hum. Genet. 56: 183-187, 1995.

 Goizet C, Boukhris A, Durr A, Beetz C, Truchetto J, Tesson C, Tsaousidou M, Forlani S, Guyant-Maréchal L, Fontaine B, Guimarães J, Isidor B, Chazouillères O, Wendum D, Grid D, Chevy F, Chinnery PF, Coutinho P, Azulay JP, Feki I, Mochel F, Wolf C, Mhiri C, Crosby A, Brice A, Stevanin G. CYP7B1 mutations in pure and complex forms of hereditary spastic paraplegia type 5. Brain. 2009 Jun;132(Pt 6):1589-600. Epub 2009 May 12. 129 

 Goizet C, Boukhris A, Maltete D, Guyant-Maréchal L, Truchetto J, Mundwiller E, Hanein S, Jonveaux P, Roelens F, Loureiro J, Godet E, Forlani S, Melki J, Auer-Grumbach M, Fernandez JC, Martin-Hardy P, Sibon I, Sole G, Orignac I, Mhiri C, Coutinho P, Durr A, Brice A, Stevanin G. SPG15 is the second most common cause of hereditary spastic paraplegia with thin corpus callosum. Neurology. 2009 Oct 6;73(14):1111-9. 

Goizet C, Boukhris A, Mundwiller E, Tallaksen C, Forlani S, Toutain A, Carriere N, Paquis V, Depienne C, Durr A, Stevanin G, Brice A. Complicated forms of autosomal dominant hereditary spastic paraplegia are frequent in SPG10. Hum Mutat. 2009 Feb;30(2):E376-85.

 Goytain A, Hines RM, El Husseini A, Quamme GA: NIPA1(SPG6), the basis for autosomal dominant form of hereditary spastic paraplegia, encodes a functional Mg2+ transporter.J Biol Chem 2007, 282:8060–8068.  Grieco GS, Malandrini A, Comanducci G, et al. Novel SACS mutations in autosomal recessive spastic ataxia of Charlevoix-Saguenay type. Neurology 2004; 62:103–106.  Gyapay, G. et. al. 1994. Généthon Human Genetic Linkage Map. Nature Genet. 7:246–339.  Haberlová J, Claeys KG, Zámecník J, De Jonghe P, Seeman P. Extending the clinical spectrum of SPG3A mutations to a very severe and very early complicated phenotype. J Neurol. 2008 Jun;255(6):927-8.  Hanein S, Durr A, Ribai P, et al.:A novel locus for autosomal dominant “uncomplicated” hereditary spastic paraplegia maps to chromosome 8p21.1-q13.3. Hum Genet 2007,122:261–273.  Hanein S, Martin E, Boukhris A, Byrne P, Goizet C, Hamri A, Benomar A, Lossos A, Denora P, Fernandez J, Elleuch N, Forlani S, Durr A, Feki I, Hutchinson M, Santorelli FM, Mhiri C, Brice A, Stevanin G. Identification of the SPG15 gene, encoding spastizin, as a frequent cause of complicated autosomal-recessive spastic paraplegia, including Kjellin syndrome. Am J Hum Genet. 2008 Apr;82(4):992-1002.  Hanna MC, Blackstone C. Interaction of the SPG21 protein ACP33/maspardin with the aldehyde dehydrogenase ALDH16A1. Neurogenetics. 2009 Jul;10(3):217-28. Epub 2009 Jan 31.  Hansen J, Coryden TJ, Palmfeldt J, et al. Decreased expression of mitochondrial matrix proteases Lon and ClpP in cells from patient with hereditary spastic paraplegia (SPG13). Neuroscience 2008; 153: 474–82.  HaraK, ShimboJ, Nozaki H, et al. Sacsin-related ataxia with neither retinal hypermyelination nor spasticity. MovDisord2007; 22:1362–1363. 

Harding, A. E. Hereditary 'pure' spastic paraplegia: a clinical and genetic study of 22 families. J. Neurol. Neurosurg. Psychiat. 44: 871-883, 1981.



Hazan, J.; Lamy, C.; Melki, J.; Munnich, A.; de Recondo, J.; Weissenbach, J. Autosomal dominant familial spastic paraplegia is genetically heterogeneous and one locus maps to chromosome 14q. Nature Genet. 5: 163-167, 1993. 130 

 HazanJ,FonknechtenN,Mavel D,etal. Spastin, a new AAA protein, is altered in the most frequent form of autosomal dominant spastic paraplegia. Nat Genet 1999; 23:296–303.; 7  Hedera P, Eldevik OP, Maly P, et al. Spinal cord magnetic resonance imaging in autosomal dominant hereditary spastic paraplegia. Neuroradiology 2005;47:730 –34. 

Hedera P, Fenichel GM, Blair M, Haines JL. Novel mutation in the SPG3A gene in an African American family with an early onset of hereditary spastic paraplegia. Arch Neurol 2004;61:1600-1603.

 Hewamadduma C, McDermott C, Kirby J, Grierson A, Panayi M, Dalton A, Rajabally Y, Shaw P. New pedigrees and novel mutation expand the phenotype of REEP1-associated hereditary spastic paraplegia (HSP). Neurogenetics. 2009 Apr;10(2):105-10. Epub 2008 Nov 26.  Hewamadduma CA, Kirby J, Kershaw C, Martindale J, Dalton A, McDermott CJ, Shaw PJ. HSP60 is a rare cause of hereditary spastic paraparesis, but may act as a genetic modifier. Neurology. 2008 May 6;70(19):1717-8. 

Hirayama, K.; Takayanagi, T.; Nakamura, R.; Yanagisawa, N.; Hattori, T.; Kita, K.; Yanagimoto, S.; Fujita, M.; Nagaoka, M.; Satomura, Y.; Sobue, I.; Iizuka, R.; Toyokura, Y.; Satoyoshi, E. Spinocerebellar degenerations in Japan: a nationwide epidemiological and clinical study. Acta Neurol. Scand. 89 (suppl. 153): 1-22, 1994.



Hodgkinson CA, Bohlega S, Abu-Amero SN, et al. A novel form of autosomal recessive pure hereditary spastic paraplegia maps to chromosome 13q14. Neurology 2002;59:1905– 09



Hollenbeck, P. J. & Saxton, W. M. The axonal transport of mitochondria. J. Cell Sci. 118, 5411–5419 (2005).

 Hourani R, El-Hajj T, Barada WH, Hourani M, Yamout BI. MR imaging findings in autosomal recessive hereditary spastic paraplegia. AJNR Am J Neuroradiol. 2009 May;30(5):936-40. Epub 2009 Feb 4.  Hu G, Agarwal P. Human disease-drug network based on genomic expression profiles. PLoS One. 2009 Aug 6;4(8):e6536.  Hu J, Shibata Y, Zhu PP, Voss C, Rismanchi N, Prinz WA, Rapoport TA, Blackstone C. A class of dynamin-like GTPases involved in the generation of the tubular ER network. Cell. 2009 Aug 7;138(3):549-61. 

Huang, S.; Zhuyu; Li, H.; Labu; Baizhu; Lo, W. H. Y.; Fischer, C.; Vogel, F. Another pedigree with pure autosomal dominant spastic paraplegia (AD-FSP) from Tibet mapping to 14q11.2-q24.3. Hum. Genet. 100: 620-623, 1997.

 Ito D, Suzuki N. Seipinopathy: a novel endoplasmic reticulum stress-associated disease. Brain. 2009 Jan;132(Pt 1):8-15. Epub 2008 Sep 12. Review.  131 

Ivanova, N.; Claeys, K. G.; Deconinck, T.; Litvinenko, I.; Jordanova, A.; Auer-Grumbach, M.; Haberlova, J.; Lofgren, A.; Smeyers, G.; Nelis, E.; Mercelis, R.; Plecko, B.; and 11

others Hereditary spastic paraplegia 3A associated with axonal neuropathy. Arch. Neurol. 64: 706-713, 2007. 

Jouet, M. et al. X-linked spastic paraplegia (SPG1), MASA syndrome and X-linked hydrocephalus result from mutations in the L1 gene. Nature Genet. 7, 402–407 (1994).

 Kassubek J, Sperfeld AD, Baumgartner A, et al. Brain atrophy in pure and complicated hereditary spastic paraparesis: a quantitative 3D MRI study. Eur J Neurol 2006;13:880 – 86.  Klebe S, Durr A, Bouslam N et al.: Spastic paraplegia 5: locus refinement, candidate gene analysis and clinical description. Am J Med Genet B Neuropsychiatr Genet 2007, 144:854– 861.  Krabbe K, Nielsen JE, Fallentin E, et al. MRI of autosomal dominant pure spastic paraplegia. Neuroradiology 1997;39:724 –27  Kuru S, Sakai M, Konagaya M, et al. Autopsy case of hereditary spastic paraplegia with thin corpus callosum showing severe gliosis in the cerebral white matter. Neuropathology 2005;25:346 –52Eur Neurol 2005;54:181– 85  Lee M, Paik SK, Lee MJ, Kim YJ, Kim S, Nahm M, Oh SJ, Kim HM, Yim J, Lee CJ, Bae YC, Lee S. Drosophila Atlastin regulates the stability of muscle microtubules and is required for synapse development. Dev Biol. 2009 Jun 15;330(2):250-62. Epub 2009 Mar 31.  Leone M, Bottachi E, D’Alessandro G, Kustermann S (1995). Hereditary ataxias and paraplegias in Valle d’Aosta, Italy: a study of prevalence and disability. Acta Neurol Scand 91: 183–187.  Lesca G, Eymard-Pierre E, Santorelli FM, et al. Infantile ascending hereditary spastic paralysis (IAHSP): clinical features in 11 families. Neurology 2003;60:674 – 82.  Lin P, Li J, Liu Q, Mao F, Li J, Qiu R, Hu H, Song Y, Yang Y, Gao G, Yan C, Yang W, Shao C, Gong Y. A missense mutation in SLC33A1, which encodes the acetyl-CoA transporter, causes autosomal dominant spastic paraplegia (SPG42). Am J Hum Genet. 2008 Dec;83(6):752-9.  Loureiro JL, Miller-Fleming L, Thieleke-Matos C, Magalhães P, Cruz VT, Coutinho P, Sequeiros J, Silveira I. Novel SPG3A and SPG4 mutations in dominant spastic paraplegia families. Acta Neurol Scand. 2009 Feb;119(2):113-8. Epub 2008 Jul 29.  Lu J, Rashid F, Byrne PC: The hereditary spastic paraplegia protein spartin localises to mitochondria. J Neurochem 2006, 98:1908–1919.  Magen D, Georgopoulos C, Bross P, et al. Mitochondrial hsp60 chaperonopathy causes an autosomal-recessive neurodegenerative disorder linked to brain hypomyelination and leukodystrophy. Am J Hum Genet 2008;83:30–42.  Maltecca F, Aghaie A, Schroeder DG, Cassina L, Taylor BA, Phillips SJ, Malaguti M, Previtali S, Guénet JL, Quattrini A, Cox GA, Casari G. The mitochondrial protease 132 

AFG3L2 is essential for axonal development. J Neurosci. 2008 Mar 12;28(11):2827-36.  Mannan AU, Krawan P, Sauter SM, et al. ZFYVE27 (SPG33), a novel spastin binding protein is mutated in hereditary spastic paraplegia. Am J Hum Genet 2006; 79: 351–57.  Mannan AU. The role of ZFYVE27/protrudin in hereditary spastic paraplegia [author’s reply]. Am J Hum Genet 2008; 83: 128–30.  Martignoni M, Riano E, Rugarli EI. The role of ZFYVE27/ protrudin in hereditary spastic paraplegia. Am J Hum Genet 2008; 83: 127–28.  Martinez MF, Kobayashi H, Pegoraro E, et al.: Genetic localization of a new locus for recessive familial spastic paraparesis to 15q13-15.Neurology1999,53:50–56.  Matsui M, Kawarai T, Hase Y, Tomimoto H, Iseki K, Rogaeva E, Orlacchio A, Bernardi G, St George-Hyslop P, Takahashi R, Matsui M. A novel mutation in the SPG3A gene (atlastin) in hereditary spastic paraplegia. J Neurol. 2007 Jul;254(7):972-4.  McDermott CJ, Burness CE, Kirby J, et al. Clinical features of hereditary spastic paraplegia due to spastin mutations. Neurology 2006; 67: 45–51.  McDermott CJ, Dayaratne RK, Tomkins J, et al. Paraplegin gene analysis in hereditary spastic paraparesis (HSP) pedigrees in northeast England. Neurology 2001;56: 476–471. 



McDermott, C., White, K., Bushby, K., Shaw, P., 2000. Hereditary spastic paraparesis: a review of new developments. J. Neurol. Neurosurg. Psychiatry 69, 150–160; McLeod, J. G.; Morgan, J. A.; Reye, C. Electrophysiological studies in familial spastic paraplegia. J. Neurol. Neurosurg. Psychiat. 40: 611-615, 1977.

 McMonagle P, Byrne P, Hutchinson M. Further evidence of dementia in SPG4-linked autosomal dominant hereditary spastic paraplegia. Neurology 2004; 62: 407–10.  McMonagle P, Webb S, Hutchinson M. The prevalence of pure HSP in the island of Ireland. J Neurol Neurosurg Psychiatry 2002; 72: 43–46.  Meijer IA, HandCK, Grewal KK, et al. A locus for autosomal dominant hereditary spastic ataxia, SAX1, maps to chromosome12p13. AmJ Hum Genet 2002. 

Meijer, I. A.; Dion, P.; Laurent, S.; Dupre, N.; Brais, B.; Levert, A.; Puymirat, J.; Rioux, M. F.; Sylvain, M.; Zhu, P.-P.; Soderblom, C.; Stadler, J.; Blackstone, C.; Rouleau, G. A. Characterization of a novel SPG3A deletion in a French-Canadian family. Ann. Neurol. 61: 599-603, 2007.



Muglia, M.; Magariello, A.; Nicoletti, G.; Patitucci, A.; Gabriele, A. L.; Conforti, F. L.; Mazzei, R.; Caracciolo, M.; Ardito, B.; Lastilla, M.; Tedeschi, G.; Quattrone, A. Further evidence that SPG3A gene mutations cause autosomal dominant hereditary spastic paraplegia. Ann. Neurol. 51: 794-795, 2002.

 Muriel MP, Dauphin A, Namekawa M, Gervais A, Brice A, Ruberg M. Atlastin-1, the dynamin-like GTPase responsible for spastic paraplegia SPG3A, remodels lipid membranes 133 

and may form tubules and vesicles in the endoplasmic reticulum. J Neurochem. 2009 Sep;110(5):1607-16. Epub 2009 Jul 1.  Murphy S, Gorman G, Beetz C, Byrne P, Dytko M, McMonagle P, Kinsella K, Farrell M, Hutchinson M. Dementia in SPG4 hereditary spastic paraplegia: clinical, genetic, and neuropathologic evidence. Neurology. 2009 Aug 4;73(5):378-84.  Nakamura A, Izumi K, Umehara F, et al. Familial spastic paraplegia with mental impairment and thin corpus callosum. J Neurol Sci 1995;131:35– 42  Namekawa, M. et al. Mutations in the SPG3A gene encoding the GTPase atlastin interfere with vesicle trafficking in the ER/Golgi interface and Golgi morphogenesis. Mol. Cell Neurosci. 35, 1–13, 2007 

Namekawa, M.; Nelson, I.; Ribai, P.; Durr, A.; Denis, E.; Stevanin, G.; Ruberg, M.; Brice, A. A founder effect and mutational hot spots may contribute to the most frequent mutations in the SPG3A gene. (Letter) Neurogenetics 7: 131-132, 2006.



Namekawa, M.; Ribai, P.; Nelson, I.; Forlani, S.; Fellmann, F.; Goizet, C.; Depienne, C.; Stevanin, G.; Ruberg, M.; Durr, A.; Brice, A. SPG3A is the most frequent cause of hereditary spastic paraplegia with onset before age 10 years. Neurology 66: 112-114, 2006.

 Olmez A, Uyanik G, Ozgul RK, et al.: Further clinical and genetic characterization of SPG11: hereditary spastic paraplegia with thin corpus callosum.Neuropediatrics 2006, 37:59–66. 

Opjordsmoen, S.; Nyberg-Hansen, R. Hereditary spastic paraplegia with neurogenic bladder disturbances and syndactyly. Acta Neurol. Scand. 61: 35-41, 1980.

 Orlacchio A, Kawarai T, Gaudiello F, St George-Hyslop PH, Floris R, Bernardi G. New locus for hereditary spastic paraplegia maps to chromosome 1p31.1-1p21.1. Ann Neurol. 2005 Sep;58(3):423-9.  Orlacchio A, Kawarai T, Gaudiello F, Totaro A, Schillaci O, Stefani A, Floris R, St GeorgeHyslop PH, Sorbi S, Bernardi G. Clinical and genetic study of a large SPG4 Italian family. Mov Disord. 2005 Aug;20(8):1055-9.  Orlacchio A, Kawarai T, Totaro A, Errico A, St George-Hyslop PH, Rugarli EI, Bernardi G. Hereditary spastic paraplegia: clinical genetic study of 15 families. Arch Neurol. 2004 Jun;61(6):849-55.  Orlacchio A., Kawarai T., Rogaeva E., Song Y.Q., Paterson A.D., Bernardi G., St. GorgeHyslop P.H.. Clinical and genetic study of a large Italian family linked to SPG12 locus. Neurology. 2002, 59:1395-1401.  Orlacchio A., Patrono C., Gaudiello F., Rocchi C., Moschella V., Floris R., Bernardi G., Kawarai T. Silver syndrome variant of hereditary spastic paraplegia: a locus to 4p and allelism with SPG4. Neurology. 2008, 70:1959-1966. 

Orso, G.; Pendin, D.; Liu, S.; Tosetto, J.; Moss, T. J.; Faust, J. E.; Micaroni, M.; Egorova, A.; Martinuzzi, A.; McNew, J. A.; Daga, A. Homotypic fusion of ER membranes requires 134 

the dynamin-like GTPase Atlastin. Nature, 2009, 460: 978-983.  Orthmann-Murphy JL, Salsano E, Abrams CK, Bizzi A, Uziel G, Freidin MM, Lamantea E, Zeviani M, Scherer SS, Pareyson D. Hereditary spastic paraplegia is a novel phenotype for GJA12/GJC2 mutations. Brain. 2009 Feb;132(Pt 2):426-38. Epub 2008 Dec 4.  OuyangY, TakiyamaY, SakoeK, et al. Sacsin related ataxia (ARSACS): expanding the genotype upstream from the gigantic exon. Neurology 2006; 66:1103–1104.  Panza E, Pippucci T, Cusano R, Lo Nigro C, Pradella L, Contardi S, Rouleau GA, Stevanin G, Ravazzolo R, Liguori R, Montagna P, Romeo G, Seri M. Refinement of the SPG9 locus on chromosome 10q23.3-24.2 and exclusion of candidate genes. Eur J Neurol. 2008 May;15(5):520-4. 

Polo JM, Calleja J, Combarros O, Berciano J: Hereditary ataxias and paraplegias in Cantabria, Spain. An epidemiological and clinical study. Brain 1991; 114 (Pt 2): 855–866;



Polo, J. M.; Calleja, J.; Combarros, O.; Berciano, J. Hereditary 'pure' spastic paraplegia: a study of nine families. J. Neurol. Neurosurg. Psychiat. 56: 175-181, 1993.



Rainier, S.; Hedera, P.; Alvarado, D.; Zhao, X.; Kleopa, K. A.; Heiman-Patterson, T.; Fink, J. K. Hereditary spastic paraplegia linked to chromosome 14q11-q21: reduction of the SPG3 locus interval from 5.3 to 2.7 cM. J. Med. Genet. 38: e39, 2001. Note: Electronic Article.



Rainier, S.; Sher, C.; Reish, O.; Thomas, D.; Fink, J. K. De novo occurrence of novel SPG3A/atlastin mutation presenting as cerebral palsy. Arch. Neurol., 2006; 63: 445-447.



Reid E. Science in motion: common molecular pathological themes emerge in the hereditary spastic paraplegias. J Med Genet 2003;40:81–86



Reid, E. et al. A kinesin heavy chain (KIF5A) mutation in hereditary spastic paraplegia (SPG10). Am. J. Hum. Genet. 71, 1189–1194, 2002



Reid, E., 1999. The hereditary spastic paraplegias. J. Neurol. 246, 995-1003;

 Riano E, Martignoni M, Mancuso G, Cartelli D, Crippa F, Toldo I, Siciliano G, Di Bella D, Taroni F, Bassi MT, Cappelletti G, Rugarli EI. Pleiotropic effects of spastin on neurite growth depending on expression levels. J Neurochem. 2009 Mar;108(5):1277-88. Epub 2009 Jan 29.  Robay D, Patel H, Simpson MA, et al.: Endogenous spartin, mutated in hereditary spastic paraplegia, has a complex subcellular localization suggesting diverse roles in neurons. Exp Cell Res 2006, 312:2764–2777. 

Sack, G. H.; Huether, C. A.; Garg, N. Familial spastic paraplegia--clinical and pathologic studies in a large kindred. Johns Hopkins Med. J. 143: 117-121, 1978.

 Salameh JS, Shenoy AM, David WS. Novel SPG3A and SPG4 mutations in two patients with Silver syndrome. J Clin Neuromuscul Dis. 2009 Sep;11(1):57-9. 135 

 Salinas S, Proukakis C, Crosby A., Warner T.T. Hereditary spastic paraplegia: clinical feature and pathogenetic mechanism. Lancet Neurol (2008); 7:1127-38. 

Saugier-Veber, P. et al. X-linked spastic paraplegia and Pelizaeus–Merzbacher disease are allelic disorders at the proteolipid protein locus. Nature Genet. 6, 257–262 (1994).



Sauter SM, Engel W, Neumann LM, Kunze J, Neesen J. Novel mutations in the Atlastin gene (SPG3A) in families with autosomal dominant hereditary spastic paraplegia and evidence for late onset forms of HSP linked to the SPG3A locus. Hum Mut 2004;23:98101.



Sauter, S., Neesen, J., Paulus, W., Engel, W., 1999. Hereditary spastic paraplegia (HSP). Dtsch. Arztebl. 7, 434–440;



Schady, W.; Dick, J. P. R.; Sheard, A.; Crampton, S. Central motor conduction studies in hereditary spastic paraplegia. J. Neurol. Neurosurg. Psychiat. 54: 775-779, 1991.



Schady, W.; Sheard, A. A quantitative study of sensory function in hereditary spastic paraplegia. Brain 113: 709-720, 1990.



Schady, W.; Smith, C. M. L. Sensory neuropathy in hereditary spastic paraplegia. J. Neurol. Neurosurg. Psychiat. 57: 693-698, 1994.



Scheltens, P.; Bruyn, R. P. M.; Hazenberg, G. J. A Dutch family with autosomal dominant pure spastic paraparesis (Strumpell's disease). Acta Neurol. Scand. 82: 169-173, 1990.

 Schickel J, Pamminger T, Ehrsam A, et al.: Isoform-specific increase of spastin stability by N-terminal missense variants including intragenic modifiers of SPG4 hereditary spastic paraplegia.Eur J Neurol 2007,14:1322–1328.  Schouten JP et al. (2002) Relative quantification of 40 nucleic acid sequences by multiplex ligation-dependent probe amplification Nucleic Acids Res 30, e57.  Schüle R, Bonin M, Dürr A, Forlani S, Sperfeld AD, Klimpe S, Mueller JC, Seibel A, van de Warrenburg BP, Bauer P, Schöls L. Autosomal dominant spastic paraplegia with peripheral neuropathy maps to chr12q23-24. Neurology. 2009 Jun 2;72(22):1893-8. Epub 2009 Apr 8.  Schüle R, Brandt E, Karle KN, Tsaousidou M, Klebe S, Klimpe S, Auer-Grumbach M, Crosby AH, Hübner CA, Schöls L, Deufel T, Beetz C. Analysis of CYP7B1 in nonconsanguineous cases of hereditary spastic paraplegia.Neurogenetics. 2009 Apr;10(2):97104. Epub 2008 Oct 15. 

Schule, R.; Holland-Letz, T.; Klimpe, S.; Kassubek, J.; Klopstock, T.; Mall, V.; Otto, S.; Winner, B.; Schols, L. :The spastic paraplegia rating scale (SPRS): a reliable and valid measure of disease severity. Neurology 67: 430-434, 2006.

 Schulte T, Miterski B, Bornke C, et al.: Neurophysiological findings in SPG4 patients differ from other types of spastic paraplegia. Neurology 2003, 60:1529–1532. 

Schwarz, G. A.; Liu, C. N. Hereditary (familial) spastic paraplegia: further clinical and pathologic observations. Arch. Neurol. Psychiat. 75: 144-162, 1956. 136 

 Scuderi C, Fichera M, Calabrese G, Elia M, Amato C, Savio M, Borgione E, Vitello GA, Musumeci SA. Posterior fossa abnormalities in hereditary spastic paraparesis with spastin mutations. J Neurol Neurosurg Psychiatry. 2009 Apr;80(4):440-3.  Seidel K, De Vos R, Derksen L, Bauer P, Riess O, den Dunnen W, Deller T, Hageman G, Rüb U. Widespread thalamic and cerebellar degeneration in a patient with a complicated hereditary spastic paraplegia (HSP).Ann Anat. 2009 Apr;191(2):203-11. Epub 2009 Jan 20. 

Seri, M.; Cusano, R.; Forabosco, P.; Cinti, R.; Caroli, F.; Picco, P.; Bini, R.; Morra, V. B.; De Michele, G.; Lerone, M.; Silengo, M.; Pela, I.; Borrone, C.; Romeo, G.; Devoto, M. Genetic mapping to 10q23.3-q24.2, in a large Italian pedigree, of a new syndrome showing bilateral cataracts, gastroesophageal reflux, and spastic paraparesis with amyotrophy. Am. J. Hum. Genet. 64: 586-593, 1999

 Shimazaki H, SakoeK, NiijimaK, NakanoI, et al. An unusual case of a spasticity-lacking phenotype with a novel SACS mutation. JNeurol Sci 2007; 255:87–89.  Silva MC, Coutinho P, Pinheiro CD, Neves JM, Serrano P (1997). Hereditary ataxias and spastic paraplegias: methological aspects of a prevalence study in Portugal. JClin Epidemiol 50: 1377–1384. 

Skre, H. Hereditary spastic paraplegia in Western Norway. Clin. Genet. 6: 165-183, 1974.

 Smith BN, Bevan S, Vance C, Renwick P, Wilkinson P, Proukakis C, Squitieri F, Berardelli A, Warner TT, Reid E, Shaw CE. Four novel SPG3A/atlastin mutations identified in autosomal dominant hereditary spastic paraplegia kindreds with intra-familial variability in age of onset and complex phenotype. Clin Genet. 2009 May;75(5):485-9.  Soderblom C, Blackstone C. Traffic accidents; molecular genetic insights into the pathogenesis of hereditary spastic paraplegias. Pharmacol Ther 2006; 109: 42–56.  Solowska JM, Morfini G, Falnikar A, et al. Quantitative and functional analyses of spastin in the nervous system: implications for hereditary spastic paraplegia. J Neurosci 2008; 28: 2147–57.  Somasundaram S, Raghavendra S, Singh A., et al. Hereditary spastic paraplegia with a thin corpus callosum. Pediatr Radiol 2007;37:503– 05.  Sperfeld AD, Baumgartner A, Kassubek J. Magnetic resonance investigation of the upper spinal cord in pure and complicated hereditary spastic paraparesis. Eur Neurol 2005;54:181– 85.  Sperfeld AD, Bretschneider V, Flaith L, et al. MR-pathologic comparison of the upper spinal cord in different motor neuron diseases. Eur Neurol 2005;53:74 –77. 

Steinmuller, R.; Lantigua-Cruz, A.; Garcia-Garcia, R.; Kostrzewa, M.; Steinberger, D.; Muller, U. Evidence of a third locus in X-linked recessive spastic paraplegia. Hum. Genet. 100: 287-289, 1997

 Stevanin G, Azzedine H, Denora P, et al.: Mutations in SPG11 are frequent in autosomal 137 

recessive spastic paraplegia with thin corpus callosum, cognitive decline and lower motor neuron degeneration. Brain 2008, 131:772–784.  Stevanin G, Ruberg M, Brice A. Recent advances in the genetics of spastic paraplegias. Curr Neurol Neurosci Rep. 2008 May;8(3):198-210. Review.  Svenson IK, Kloos MT, Gaskell PC, et al. Intragenic modifiers of hereditary spastic paraplegia due to spastin gene mutations. Neurogenetics 2004; 5:157–164  Svenstrup K, Bross P, Koefoed P, Hjermind LE, Eiberg H, Born AP, Vissing J, Gyllenborg J, Nørremølle A, Hasholt L, Nielsen JE. Sequence variants in SPAST, SPG3A and HSPD1 in hereditary spastic paraplegia. J Neurol Sci. 2009 Sep 15;284(1-2):90-5. Epub 2009 May 6.  Tallaksen CM, Guichart-Gomez E, Verpillat P, et al. Subtle cognitive impairment but no dementia in patients with spastin mutations. Arch Neurol 2003; 60: 1113–18. 

Tallaksen, C.M., Durr, A., Brice, A., 2001. Recent advances in hereditary spastic paraplegia. Curr. Opin. Neurol. 14, 457–463;

 Teive HA, Iwamoto FM, Della Coletta MV, et al. Hereditary spastic paraplegia associated with thin corpus callosum. Arq Neuropsiquiatr 2001;59:790 –92. 

Tessa, A.; Casali, C.; Damiano, M.; Bruno, C.; Fortini, D.; Patrono, C.; Cricchi, F.; Valoppi, M.; Nappi, G.; Amabile, G. A.; Bertini, E.; Santorelli, F. M. SPG3A: an additional family carrying a new atlastin mutation. Neurology 59: 2002-2005, 2002.

 Thiffault I, RiouxMF, Tetreault M,et al. A new autosomal recessive spastic ataxia associated with frequent white matter changes maps to 2q33–34. Brain 2006; 129:2332-2340. 

Thurmon, T. F.; He, C.; Haskell, C.; Thorpe, P.; Thurmon, S. G.; Rosen, D. R. Genetic anticipation in a large family with pure autosomal dominant hereditary spastic paraplegia. Am. J. Med. Genet. 83: 392-396, 1999.

 Tsang HT, Edwards TL, Wang X, Connell JW, Davies RJ, Durrington HJ, O'Kane CJ, Luzio JP, Reid E. The hereditary spastic paraplegia proteins NIPA1, spastin and spartin are inhibitors of mammalian BMP signalling. Hum Mol Genet. 2009 Oct 15;18(20):3805-21. Epub 2009 Jul 20.  Tsaousidou MK, Ouahchi K, Warner TT, et al.: Sequence alterations within CYP7B1 implicate defective cholesterol homeostasis in motor-neuron degeneration. Am J Hum Genet 2008, 82:510–515.  van Niekerk, E. A. et al. Sumoylation in axons triggers retrograde transport of the RNAbinding protein La. Proc. Natl Acad. Sci. USA 104, 12913–12918 (2007)  Wang X, Shaw WR, Tsang HT, Reid E, O’Kane CJ. Drosophila spichthyin inhibits BMP signalling and regulates synaptic growth and axonal microtubules. Nat Neurosci 2007; 10: 177–85.  Warner TT. Hereditary spastic paraplegia. ACNR Adv Clin Neurosci Rehabil 2007; 6: 16–17 138 

 Weissenbach, J., et. al. 1992. A second-generation linkage map of the human genome. Nature. 359:794–801. 

Wharton, S.B., McDermott, C.J., Grierson, A.J., Wood, J.D., Gelsthorpe, C., Ince, P.G., Shaw, P.J. The cellular and molecular pathology of the motor system in hereditary spastic paraparesis due to mutation of the spastin gene. J. Neuropathol. Exp. Neurol. 2003; 62: 1166–1177.

 White KD, Ince PG, Lusher M, et al. Clinical and pathological findings in hereditary spastic paraplegia with spastin mutations. Neurology 2000; 55: 89–95.  Wilkinson PA, Crosby AH, Turner C, et al. A clinical, genetic and biochemical study of SPG7 mutations in hereditary spastic paraplegia. Brain 2004; 127: 973–80. 



Wilkinson PA, Hart PE, Patel H, Warner TT, Crosby AH. SPG3A mutation screening in English families with early onset autosomal dominant hereditary spastic paraplegia. J Neurol Sci 2003;216:43-45. Yanase, D., Komai, K., Hamaguchi, T., Okino, S., Yokoji, H., Makifuchi, T., Takano, H., Yamada, M., 2004. Hereditary spastic paraplegia with frontal lobe dysfunction. Neurology 63, 2149–2152

 Yang, D. et al. Structural basis for midbody targeting of spastin by the ESCRT-III protein CHMP1B. Nature Struct. Mol. Biol. 15, 1278–1286 (2008).  Zhao GH, Hu ZM, Shen L, Jiang H, Ren ZJ, Liu XM, Xia K, Guo P, Pan Q, Tang BS. A novel candidate locus on chromosome 11p14.1-p11.2 for autosomal dominant hereditary spastic paraplegia. Chin Med J (Engl). 2008 Mar 5;121(5):430-4. 

Zhao, X.; Alvarado, D.; Rainier, S.; Lemons, R.; Hedera, P.; Weber, C. H.; Tukel, T.; Apak, M.; Heiman-Patterson, T.; Ming, L.; Bui, M.; Fink, J. K. Mutations in a newly identified GTPase gene cause autosomal dominant hereditary spastic paraplegia. Nature Genet. 29: 326-331, 2001.

 Zhu, P. P., Soderblom, C., Tao-Cheng, J. H., Stadler, J. & Blackstone, C. SPG3A protein atlastin-1 is enriched in growth cones and promotes axon elongation during neuronal development. Hum. Mol. Genet. 15, 1343–1353, 2006 

Zhu, P.; Patterson, A.; Lavoie, B.; Stadler, J.; Shoeb, M.; Patel, R.; Blackstone, C. Cellular localization, oligomerization, and membrane association of the hereditary spastic paraplegia 3A (SPG3A) protein atlastin. J. Biol. Chem. 278: 49063-49071, 2003.

 Zuchner S, Wang G, Tran-Viet KN, et al.: Mutations in the novel mitochondrial protein REEP1 cause hereditary spastic paraplegia type 31.Am J Hum Genet 2006, 79:365–369  Zuchner, S. et al. A new locus for dominant hereditary spastic paraplegia maps to chromosome 2p12. Neurogenetics 7, 127–129, 2006.  

139 

Capitolo 7 – APPENDICI

7.1

Protocolli clinici.

Tabella 7.1. SPRS - Scala di Valutazione per la Paraplegia Spastica.* (1) DISTANZA COPERTA DA UNA DEAMBULAZIONE SENZA SOSTE (dall’anamesi, sono consentiti aiuti per camminare) 0:

Normale, illimitata

1:

Anormale stanchezza dovuta alla spasticità dopo 500m

2:

Capacità di camminare per distanze inferiori a 500m

3:

Capacità di camminare per distanze inferiori ai 10m

4:

Incapacità a camminare

(2) QUALITA’ DELL’ANDATURA (si richiede al paziente di camminare più velocemente possibile pre una distanza di 10 metri incluso voltarsi) 0:

Normale

1:

Lieve rigidità, correre è ancora possibile

2:

Andatura francamente spastica, che interferisce con la corsa

3:

Andatura spastica che richiede l’uso del bastone /deambulatore

4:

Incapacità a camminare per una distanza di 10 metri anche con il massimo supporto

(3) MASSIMA VELOCITA’ DEL PASSO (tempo impiegato per coprire una distanza di 10 metri incluso voltarsi, preso con il cronometro) 0:

Normale

1:

Leggermente ridotto (10m: ≥ 5 sec)

2:

Moderatamente ridotto (10m: ≥ 10 sec)

3:

Gravemente ridotto (10m: ≥ 20 sec)

4:

Incapacità a camminare per una distanza di 10 metri o con un tempo ≥ 40 sec

(4) SALIRE LE SCALE (salire 5 scalini- girarsi- scendere 5 scalini) 0:

Normale: nessuna necessità di supporto alla ringhiera

1:

Danno lieve: necessità intermittente di supporto alla ringhiera

2:

Danno medio: necessità costante di supporto alla ringhiera

3:

Danno grave: necessità di supporto di un’alta persona o di ausili per camminare per effettuare il compito

4:

Incapacità di salire le scale

(5) VELOCITA’ DI SALITA DELLE SCALE (tempo impiegato per salire 5 scalini- girarsi- scendere 5 scalini, preso con un cronometro) 0:

Normale

1:

Leggermente ridotto (≥ 5 secondi per effettuare il compito)

2:

Moderatamente ridotto (≥ 10 secondi per effettuare il compito)

3:

Gravemente ridotto (≥ 20 secondi per effettuare il compito)

140 

4:

Incapacità di salire le scale

(6) ALZARSI DA UNA SEDIA (il paziente cerca di alzarsi da una sedia con lo schienale in legno o di metallo con le braccia piegate al petto) 0:

Normale

1:

Lento, o può necessitare di più di un tentativo

2:

Si spinge in su dai braccioli della sedia

3:

Tende a cadere indietro e può fare più di un tentativo ma può alzarsi senza aiuto

4:

Incapace di alzarsi senza aiuto

(7) SPASTICITA’ DEI MUSCOLI ADDUTTORI DELLE ANCHE (SCALA ASHWORTH MODIFICATA) (assegnare un punteggio al lato più gravemente affetto) 0:

Nessun incremento nel tono muscolare

1:

Lieve incremento nel tono muscolare, manifestata dal “fenomeno del temperino” (“catch and release”)

2:

Più marcato incremento nel tono muscolare persistente nella maggior parte dei movimenti

3:

Considerevole incremento nel tono muscolare- difficoltà nel movimento passivo

4:

Arti rigidi in adduzzione

(8) SPASTICITA’ ALLA FLESSIONE DEL GINOCCHIO (SCALA ASHWORTH MODIFICATA) (assegnare un punteggio al lato più gravemente affetto) 0:

Nessun incremento nel tono muscolare

1:

Lieve incremento nel tono muscolare, manifestata dal “fenomeno del temperino” (“catch and release”)

2:

Più marcato incremento nel tono muscolare persistente nella maggior parte dei movimenti

3:

Nessun incremento nel tono muscolare

4:

Rigidità negli arti in flessione o in estensione

(9) IPOSTENIA IN ADDUZIONE DELL’ANCA (MEDICAL RESEARCH COUNCIL 1976) 0:

Nessuna ipostenia

1:

Ipostenia lieve (4/5)

2:

Ipostenia moderata (3/5)

3:

Ipostenia grave (1-2/5)

4:

Paralisi (0/5)

(10) IPOSTENIA NELLA DORSIFLESSIONE DEL PIEDE (MEDICAL RESEARCH COUNCIL 1976) 0:

Nessuna ipostenia

1:

Ipostenia lieve (4/5)

2:

Ipostenia moderata (3/5)

3:

Ipostenia grave (1-2/5)

4:

Paralisi (0/5)

(11) CONTRATTURE DEGLI ARTI INFERIORI (assegnare il punteggio in posizione supina -

Anca in estensione: la colonna lombare e le cosce toccano il piano d’appoggio. Anca in abduzione: abduzione fino ad un angolo >di 60 gradi tra le gambe se possibile.

-

Ginocchia in estensione: cosce e polpaccio toccano il piano d’appoggio.

141 

-

Caviglia in estensione dorsale: >10 gradi se possibile. Caviglia in pronazione: >10 gradi se possibile.) 0:

Nessuna contrattura

1:

Lieve, non fissa, postura anomala di una articolazione (unilaterale o bilaterale)

2:

Contrattura fissa di una articolazione (unilaterale o bilaterale)

3:

Contrattura fissa di due articolazioni (unilaterale o bilaterale)

4:

Contrattura fissa di più di due articolazioni (unilaterale o bilaterale)

(12) DOLORE DOVUTO A SINTOMI CORRELATI ALLA SP 0:

Nessuno

1:

presente ≤ 50% della giornata E di intensità 0-3 su una scala visiva analogica

2:

presente ≤ 50% della giornata E di intensità 4-10 su una scala visiva analogica

3:

presente > 50% della giornata E di intensità 0-3 su una scala visiva analogica

4:

presente > 50% della giornata E di intensità 4-10 su una scala visiva analogica

(13) FUNZIONI URINARIE E RETTALI 0:

Normale funzione urinaria e rettale

1:

Urgenza urinaria e fecale (difficoltà a raggiungere il bagno in tempo)

2:

Rara o lieve incontinenza (non necessario il pannolino)

3:

Moderata incontinenza (necessario il pannolino o il catetere quando fuori casa)

4:

Permanente cateterismo o pannolino

LISTA DEI SEGNI E SINTOMI COMPLICANTI: - Ritardo mentale - Demenza - Psicosi - Epilessia - Perdita dell’acuità visiva - Cataratta - Nistagmo - Disartria - Disfagia - Atassia degli arti - Andatura atassica - Segni motori extrapiramidali - Ipotrofia muscolare (arti superiori) - Ipotrofia muscolare (arti inferiori) - Perdita del riflesso miotatico fasico (arti superiori) - Perdita del riflesso miotatico fasico (arti inferiori) - Danno della sensibilità tattile - Danno della sensibilità dolorifica - Danno delle pallestesie - Danno della sensibilità cinestetica - Danno della sensibilità termica

142 

- Dismorfismi facciali - Anomalie della cute - Anomalie scheletriche - Altro

*(adattata da Schule et al., 2006)

143 

7.2

Protocolli di laboratorio.

Tabella 7.2. Microsatelliti utilizzati per lo studio di linkage a 2 punti sulla famiglia RMFSL200. Sottotipo

Marcatori

SPG

microsatellitari

SPG3A

D14S288

Sequenze dei DYE primers

Eterozigosità

Fluorescenza

AGCTAGACTCTGCCATAAACA

0.83

NED

0.76

NED

0.85

FAM

0.86

FAM

0.78

NED

0.79

VIC

0.81

FAM

0.81

FAM

0.84

FAM

0.78

NED

0.77

NED

0.83

VIC

0.70

NED

0.79

NED

0.66

FAM

0.64

FAM

TGGAGACAGGAACAACACAC D14S276

TGCTTTACCAAGTGCATCAC AGCTCAGAATCTAGGCCCT

SPG4

D2S165

AACTTCTACCTTGGCTGTGG TTCAACNCCTTTGAGATTGT

D2S367

TTCTTTGGTCTAAGGGTCAC AGCTTCTTGTTCACAGGTGT

SPG6

D15S128

GCTGTGTGTAAGTGTGTTTTATATC GCAAGCCAGTGGAGAG

D15S165

GTTTACGCCTCATGGATTTA GGGCACACAGTCCCAA

SPG10

D12S368

GCAACACCTTTGTGATGAAAAT AGTCTGCACAGCCTGTCC

D12S83

TTTTTGGAAGTCTATCAATTTGA TAGCAGAGAAAGCCAATTCA

SPG12

D19S220

ATGTTCAGAAAGGCCATGTCATTTG TCCCTAACGGATACACAGCAACAC

D19S414

CCAGACCTGTCCATCTTGTATGAAT TTAGAACAACGCTTGGGCATTT

SPG8

D8S514

CCAGTTGGCAAGCATTGT CTGAACCCAGTAGAGTTAGGAGA

D8S284

GGGCATGTTACTGCATGTC TTTGAACACAGGTCTGCCA

SPG13

D2S306

AAAGGCTAAACAACTAAACATC CACCTTACTTTCTGCATGG

D2S335

TTAATTTTCAAGAGGGCTGA ATTCATCATTTTCTATTACTCTGTG

SPG31

D2S286

TTAAAATTGTTTCTATGACATGATG TGGTGGTTTATCTTACCAGTC

D2S388

CTAAAAAAATGTGTTAAGCAAAAA TTGGCCCTGCATTACT

Nota: i microsatelliti sono stati selezionati dall’“ABI PRISM Linkage Mapping Set version 2.5 Panel Guide”. I valori forniti sono basati sui dati di genotipizzazione dalla mappa genetica “Genethon 1994” (CEPH database). 144 

Tabella 7.3. Elenco degli oligonucleotidi utilizzati per l’amplificazione degli esoni dei geni SPG3A, SPG5A e SPG42.

Esone 1 2 3 4 5 6 7 8 9 10 11 12 13 14

SPG3A Oligonucleotidi 5’􏰀-GAGGGTGTGACGCTGGTATC-3’􏰀 5’􏰀-AAGTGGAGGGCCAGAAGACC-3’􏰀 5’􏰀-CTGTGTCGGATGTTTGAGAG-3’􏰀 5’􏰀-TGGAATGGTTACACCACAGC-3’􏰀 5’􏰀-TCGAATTGGAGAGGGATAAG-3’􏰀 5’􏰀-AAGTGCAACTTCAAGGATCC-3’􏰀 5’􏰀-TGGTAACCCTAATGACCTAG-3’􏰀 5’􏰀-ATGATTCCCAATTTCTGTTG-3’􏰀 5’􏰀-GTAGGGAATGATGAAGTAAG-3’􏰀 5’􏰀-CTAATTGGGCCAATAGTTCC-3’􏰀 5’􏰀-GTTATACCTAGAGGGAAAAG-3’􏰀 5’􏰀-GACCCTAATTAATATACCTGG-3’􏰀 5’􏰀-GGCACCTTAAAGTCCTCATA-3’􏰀 5’􏰀-CACCAAATGATCCAACAGA-3’􏰀 5’􏰀-TTAGTAGCAGCCCTGTCGTG-3’ 5’􏰀-CATCAGCCTCCTATCAGTGG-3’ 5’􏰀-TGGAGGACTGGGAAGGATTC-3’ 5’􏰀-TTCCTCGTACCTTTGCTCCC-3’ 5’􏰀-GCATTTCAGGAAAGGGAAAC-3’ 5’􏰀-ATTTCTGACAGCCAGAAATC-3’ 5’􏰀-GAAATGTGAACTGCCTGTGG-3’ 5’􏰀-AGTTGCATGAAGGATACTGG-3’ 5’􏰀-GCAGGCTCCTGATTATTAAC-3’ 5’􏰀-TCTAATGCAGTGGCTGGCAC-3’ 5’􏰀-CTGCAGGAGTATCTGTTCTG-3’ 5’􏰀-CACCAAAGATTGTTCTAATC-3’ 5’􏰀-ATGCACACATTGAGGAGTTG-3’ 5’􏰀-TACTCCGTTCTGATGGAAGC-3’

Temperatura di annealing 60°C 60°C 60°C 60°C 60°C 60°C 60°C 60°C 60°C 60°C 60°C 60°C 60°C 60°C

SPG5A esone 1 2 3 4 5 6

145 

Oligonucleotidi 5’-GAACTTTTGTCATTCAGCCT-3’ 5’-TGTCTGCACTGGAAATCATG-3’ 5’-AGCAGTGCAATCCATGCAGT-3’ 5’-GGTTCCCTAAGTACCATGAAG-3’ 5’-CATGTAGTGTACCTTCGAATG-3’ 5’-TTCAAGGTCGCCATTTTGTC-3’ 5’-GGTTCTCATTAGCATGCACTG-3’ 5’-AATTAGGCAGCTGTGTCCTC-3’ 5’-GAGAGCAGTTTTCAGGACCA-3’ 5’-GGCGCAATGTCCACTTCATT-3’ 5’-AGCAACTTTGTGGACTTGAAC-3’ 5’-CTGGACTGATATCAGATCAAAT-3’

Temperatura di annealing 56°C 57°C 57°C 57°C 57°C 57°C

SPG42 esone 1 2 3 4 5 6

Oligonucleotidi 5’- GTGCCCTTATCGCTCTGAG -3’ 5’-GTGTTATTTGATGGGTTGC-3’ 5’-CCTGCCTTTTTGGTTGTTGT-3’ 5’-TGGTAGTGGAAAGGGACCTG-3’ 5’-TGACTCATGGGGAGATACT-3’ 5’-AACTCAGCAGGACTACGAT-3’ 5’-ATTGGTAGAAGAGGGAGTAC-3’ 5’-TTTAAGACAACTGTAGAAAGC-3’ 5’-GTCACATCTTTGTATTGCTGG-3’ 5’-ACGCCTTTAAGGGAACTAG-3’ 5’-CACCCGTAATTCCAGCATTT-3’ 5’-CACCCGTGACTACTGCATTG-3’

Temperatura di annealing 60°C 60°C 60°C 60°C 60°C 60°C

146 

View more...

Comments

Copyright © 2017 DOCUMEN Inc.